ZFIN ID: ZDB-TSCRIPT-090929-4357
Transcript Name: git2a-201
Previous Names: git2-001, git2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019253 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019253|OTTDARG00000016056|ZDB-GENE-060526-267 git2a|OTTDARP00000016276 DKEY-234H16.4-001 LG_ BX323811.14 Danio rerio protein_coding NOVEL, 2938 bp
GCAGATGGCAGTCTACCGCTATCTGATGGGTTGCTGGCAA
GTATTTCCGTAGTGTAGTTTTTAACGCATCTTGACCGAGG
CTCCTCTGCTTGACTCGTCTGTCCTCATTTACAGCTAGAC
AGCCCGATATACATAATTTCACATATCGTTGCAGCAGCCA
GTGCAGATGCGTTTCTCTCCTCCGTTCGTGCGTCCTCTTC
GGGCATGAGATCCACGTTTAGTGATACAACACTTCTAAAC
GGATCCAGTCATTATGTCAATTCGGTGCATGCTTTAAATA
TATCCCTGGACGATTCTGGCTCGATAATACATGGTCATAC
CCACGCTAACGGAGACAAGGATGTCGAAACGGCTGCGAAA
TAGTGAAGTTTGTGCGGACTGCAGCACTTCAGATCCTCGC
TGGGCGTCTGTGAACAGAGGAGTGTTGATATGTGATGAGT
GCTGTAGTGTTCACCGCAGTCTGGGTCGCCACAATTCACA
AGTGCGCCATCTGTCAAACACATCTTGGCCGCCCACCCAA
CTACAGATGGTTCAGACATTATACAACAATGGCGCTAATG
CAATATGGGAGCACACTCTGCTGGACCCGTCATCCATCAT
GAGCAGCAAACGCAAGCCTAATCATCAGGATAAACTCCAC
CCCAACAAGGCAGACTTCATCAAAGCAAAGTATCAAATGC
TGGCTTACGTCCATCGTTTACCATGTCGAGATGATGACAG
TACAGCTGCCGCTGATCTAAGCAAGCAACTTCACTCCAGC
GTTCGAACAGGCAATCTTGAGACTTGTTTGCGGTTACTGT
CTCTTGGGGCTCAAGCTAACTACTTTCATCCGGAGAAAGG
GAACACTCCGCTGCACATCGCGGCTAAAGCAGGTCAAGTG
TGCCAGGCTGAGCTTCTTTGCGTTTATGGGGCAGATCCTG
GAGCTCCAGACTCCAGCGGCAAAACACCTATCAACTATGC
AAGGCAGGCTGGCCATCAGGACCTGGCAGACAGACTGGTG
GAAATACAGTACGAGCTGACAGACAGGCTGGCCTTTTACC
TCTGTGGGCGGAAGCCTGATCACAAGAGTGGACAGCATTT
CATTATACCACAGATGGCAGACAGCAGTGTGGAGTTAACA
GAGTTTGCAAAAGCTGCAAAAAGAAAACTACAGTCTCTCA
GCGATCACTTGTTTGAGGAATTGGCAATGGATGTTTATGA
TGAAGTAGACCGACGAGAGACAGATGCAGTTTGGCTGGCC
ACTCAGAACCACAGCACCTTGGTAACAGAGACAACAGTTG
TGCCTTTCCTTCCTGTCAACCCTGAGTACTCATCAACACG
AAACCAGGGAAGACAAAAGCTGGCAAGATTCAACGCTCAT
GAATTTGCCACACTTGTGATCGATATTCTAAGTGATGCAA
AGCGACGCCAGCATGGAAATCCAGTCCCAAGTCCTAAAGA
CAATGTTGATGTATTCTTCAAAAGTGGGGGCAGTCGTCAT
GGAAGTGAAAGTCAGGAAATTGACCAGCCAGATTATGACA
GCGTGGCGTCCGATGAGGACACCGATACTGATTTACGAAT
GGGCAAAGCAGACAGAACTAAAAGTCTGGACTCGGATCTC
TCCGATGGACCGGTTTCCGTGCAGGAGTTTCTGGAGGTGA
AAAACGCACTCTCAGCCTCGGAGGCCAAAATTCAGGAGCT
GATGAAGGCCAACAGTAATCTGAATGAAGAGCTGAGATTA
ATGCAGAAAAAGCTGCAGTCTCTGCAAAGCGAGAACAGCT
CTCTGAGGCGGCAGGTCTCCGCTCAACAGCCCTATCAGGC
CCCCGGCGGCCCTGACCATCCCAATCCCTCCAGTCCCTCC
TCCTGTTCCTCCTCCTCCTCTTCCTCCTCTGCCCTGAAAC
GCCACCTGTCTGCGCGCGCCAGTCGCCCCATGTCTATGTA
TGAAACCGGCTCTGGCCTGAAGCCCTTTCTTCCCAAGGGC
GAGACCCCTTACCCTGAGGAAACCTTCCCCACCCTGCAAC
CCTTCCCAGCCTATGCCTCCAAATTTGACAAGCAGAGCAG
CGTGTCTGATGGCGACTACGACAACACCGTCAACGAATCT
GATCTGGACGACTCTGGTTTTGGCCGGCGATGTCGCCTTC
GCAGCAGTGGCTGGATGGGAGAAAGCGGCTCTATCCCCGA
GCTGGAGGACCATGAGTGTGAGCTGGACCCCAGTCTGCCC
AGCACCGAAGACGTCATACGCAAAACTGAGCAGATCACCA
AGAACATTCAGGAGCTGCTGAGGGCCGCGCAGGAGAACAA
GCACGAGAGCTTTGTACCCTGCGCAGAAAGAATACATGTG
GCTGTGAATGAGATGGCGGCTCTGTTCCCCAAGAGACCAC
GTTCTGAGACGGTCAGGAACTCTCTGCGGTTATTAACGTC
CAGTGCGAATCGGCTCCAGACCGAGTGTAAGAAAGCGTCT
CCTCTGGAGAGCAGCCAGGCCTCAGACATGCAGTTGGTCA
CTCAGCAGGTCATCCAGTGTGCTTACGACATCGCCAAGGC
TGCAAAGCAACTAGTTACTATAACCACCAAAGAGAACAAC
TGATCCTACTTCCACCTGAAATGCAATCCTGACTATTTTA
GTTATTATATAATTTTTTTTATTTAATCTAAGCTGTATTT
GCATGTTTTAAGTTCTGATTTAAAGTGTATGTTATCAATG
TATCATCGTCTGGCTTGAAGCCATAAGATAAAGCCTCTTG
AGGGTGTTGTAAGGATGTGTATATGTGTTGACCTGTGAAA
GTGAGTTTGATTAGATGGCAAGTTGAGAAATTTGAGCAGA
AATGTATTCGCAATGGAGCAGCCTATCATGTACTAGATGT
AAAAAAAAATGCCTGACTCTTTGCACTATTCTGAAAACTT
TGAACCTCTTCATAATCAAATATTTAGTTCACCATTTGTG
GATGGATGTGGATGTTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
git2a-201 Contained in:
OTHER git2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019253 (1)
  • Ensembl_Trans:ENSDART00000088881 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL922870 (1) 492bp
    GenBank:AL916338 (1) 449bp
    GenBank:CK696212 (1) 437bp
    GenBank:AW421322 (1) 330bp
    CITATIONS (2)