header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4341
Transcript Name: bzw2-203
Previous Names: bzw2-002, zgc:55580-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019211 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019211|OTTDARG00000016018|ZDB-GENE-040426-746 bzw2|OTTDARP00000016235 DKEYP-25A3.4-002 LG_ BX465206.15 Danio rerio protein_coding KNOWN, 507 bp
ACATCCTCACAGGCAGAATCACAGACAGGTCTGAATGAGC
TTGTAATACAGACTTCAAAAGAGCCATTTAAACCTTGACG
GTTCTGTGGGTCTTCAAATCTTGACGGCTCTGTGTGATCT
TTAGTTCTTATTTTCTGTTGGATTCAGATCAGGACTTTTA
TGAATACCGGTAAGCAACAGAAGCCAGTGCTTACAGGCCA
GCGGTTTAAGACCAGGAAAAGGGATGAAAAGGAGAAGTTT
GAGCCTACTGTTTTCCGAGACACAATTGTTCAGGGCCTCA
ACGAAGCAGGTGGTGATCTTGATGCTCTAGCCAAATTTCT
GGATGTCACTGGGTCGAGACTAGACTACCGTCGCTATGCC
GACACCCTGTTTGACATCCTCATTGCTGGGAGCATGCTGG
CTCCCGGAGGAACACGCATTGACGACGCGGACAAGACCAA
GGTGACGCAGCACTGTGTGTTCAACGCGGAGGAAAACCAC
ACCACTATTCGCAGCTATGCTCAGGTG

bzw2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bzw2-201 (1) 883
bzw2-202 (1) 1776
bzw2-203 507
bzw2-204 (1) 703
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bzw2-203 Contained in:
[BAC] DKEYP-25A3 (1)
OTHER bzw2-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019211 (1)
  • Ensembl_Trans:ENSDART00000144337 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BG304859 (1) 523bp
    GenBank:BU709768 (1) 523bp
    CITATIONS (2)