header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4262
Transcript Name: rchy1-201
Previous Name: rchy1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018941 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018941|OTTDARG00000015795|ZDB-GENE-040801-73 rchy1|OTTDARP00000015983 CH211-12E13.3-001 LG_ AL845369.7 Danio rerio protein_coding KNOWN, 909 bp
ATGAAACATGGCCGCCACGAAAGTGGGATGTGAACATTAT
GTTCGCAGCTGTTTATTAAAAGCTCCCTGCTGTGGGAAAT
TTTATGTTTGCAGACTCTGTCATGATGCAGAAGAGACCCA
TCAAATGGACCGGTTTAAGGTCCAAGAGGTCAAATGTGCA
GTTTGCAATACTATTCAAGAGGCTCAACAGATATGTAAAG
AGTGTGAAGTGAAGTTCGGAGAATATTACTGTGACATTTG
CCATCTATTTGACAAAGACAAGAAGCAGTACCACTGCCAG
CCCTGTGGGATATGCAGGATTGGTCCAAGAGAGAAATACT
TCCATTGTACGAAGTGTAATTTATGTTTAGGTACTGAGCT
AAAAGACAAGCACAAGTGTGTTGAGAACGTCTCCAGGCAG
AACTGTCCCGTTTGCATGGAGGACATCCACACGTCCAGAG
TTGGAGCTCACGTTCTGCCATGCGGTCATCTGCTGCACGG
AACCTGCTTTGATGACATGTTGAAAACTGGTGCGTATCGC
TGTCCTCTCTGTATGCACTCGGCCTTCAACATGAAGGAGT
ACTGGAAGCAGATGGATGAGGAAATCTCCCAGACTCCAAT
GCCCACTGAGTACCAGGACAGTACAGTCAAGATCATATGC
AATGACTGTCAGGCTCGCAGCACCGTCTCCTTTCACGTGT
TGGGCATGAAGTGCAGCAGTTGTGGCTCTTATAACACAGC
TCAGGACGGAGGGCTAATGGGAACTCCTGCTGCAAACACA
CAGACGCTTCCGGAGGAGCCCGATGCCGAGCAGCACCACT
GAAACTCCCAGATAAGCTTTTACTGGCACAGAGATACAAC
GTTCACTGCTTCCACATCTGTACTTCGGCTCATTGTGTTC
TGCTTGAATAAAATGATTGTTAACCTATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rchy1-201 Contained in:

OTHER rchy1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018941 (1)
  • Ensembl_Trans:ENSDART00000003273 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC078283 (1) 945 bp
    GenBank:AF262047 (1) 850 bp
    GenBank:CB358159 (1) 541 bp
    GenBank:AL920229 (1) 524 bp
    GenBank:CB353685 (1) 464 bp
    GenBank:AI437075 (1) 453 bp
    GenBank:BM530026 (1) 262 bp
    CITATIONS (2)