header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4208
Transcript Name: crtap-201
Previous Name: crtap-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018817|OTTDARG00000015705|ZDB-GENE-040426-2619 crtap|OTTDARP00000015896 crtap-001 LG_none CR749752.5,BX324146.10 Danio rerio protein_coding KNOWN, 1501 bp
CCATAAGCCACCATGGCTTCCTCATTCCATTGCATCCGAA
TTGCATTATTAATAATCTCCTTTTCCGTTTGCGTCCTCGC
GCAGTATGAGAAATATAACTTTCGCAGTTTCCCACGACAC
GAGCTGATGCCGCTGGACTCCGCGTACCGACATGCGTTAG
ACCTGTACAGTGAGGAGAAGTGGAAGGAGAGCGTGGAGTT
TCTGGAGGTCAGTCTGCGGCTCTACCGGCTGCTCCGGGAC
AGCGAGGCCTTCTGTAACCTCAACTGCAGCTCGGTCAGAC
TCGACGATGAGACCCGTTTCAGCGACTTTCCCGAGCTGCA
GGCCTTCGGTAATGTGATGAAGAGAGCTCAGTGTTTGAAG
AGGTGCAAACAGGGGCTACCAGCCTTCAGACAGACCCTCC
CCAGCCGGGACACCGTCGATGAGTTTGATAAACGGGAGCC
ATACAAGTACCTGCAGTTCGCCTACTTCAAAAGTGATAAT
TTGGCCAAAGCGGTATCCGCTGCACACACATTCCTGCTGA
AGCATCCTGATGATGAGATGATGCAGAGAAACATGAACTA
CTACAAGAGTTTACCAGGAGCTGAGGACCATCTGAAAGAC
CTGGAGACCAAATCATACGAGATGCTGTTCATTCGGGCCG
TGCGAGCGTATAATGGAGATAATTTCCGAACGTCGGTGTC
AGATATGGAGCTGGCACTGAGAGACTTTTTTAAGGTATAC
GATGAATGTATCGCCGCATCAGAAGGATCCAGACAGATTA
AAGACTTTAAAGACTTTTACCCGTCCATCGCAGATCATTA
CTCGGAGGTTCTGGAGAGGAAGGTTCGCTGTGAGAGCGAG
CTTACGCCGGTTGTTGGAGGATTTGTTGTTGAGAAATTTG
TGGCGACTATGTATCACTACCTGCAGTTTGCCTATTATAA
ATTGAATGACCTGAAGAACGCAGTGCCGTGTGTGTCCAGC
TACATGCTCTTTGACCCCAGTGATGAGGTGATGAGGAATA
ACGTGGAATATTATCGCTTCCACAGAGAAAAATTTGGCCT
CGACGATGAGGACTTCTTACCTAGAGCGGAAGCAGTGCGG
TATCATAATCAGACGACGCTACAAATGCAGATGCTGGAAT
TCGCCAAACAGAAGTTCATGCCAGATGATGAGGGTGAAGT
TGTAGAGTTTCTTGATGAATATCTGGATGCTGGGGATGAA
TAACTGATTGTGTGAGTTTGAAATAAATGTGAAAAAGACC
AGAAAGGTATTCCTCGTCCTGTAGTGTTGTTGCTGTTGTA
TTTATTTAGGGTTTGGTGATTGGAATTGTTGATATTTTTA
GTTTTTACTCATTATTTTAAAAAACGTCCTAGCACAGCAC
AGTCTAAACTCGTGCACCACAAGCCAAAAGATAATATATC
TGAATCTCAGTCCCTGTCAACTTACTGTATCTCAGAGAAA
ACAATGTTCTGTGTTTTTATTTTCTCAGATTGCTTTAATA
AAGACTTGAATACAGTAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
crtap-201 Contained in:
OTHER crtap-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018817 (1)
  • Ensembl_Trans:ENSDART00000010104 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067548 (1) 1518bp
    GenBank:CN016392 (1) 896bp
    GenBank:CK694936 (1) 686bp
    GenBank:CD778165 (1) 568bp
    GenBank:AI444316 (1) 470bp
    GenBank:AI882884 (1) 369bp
    CITATIONS (2)