header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4172
Transcript Name: nfyc-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018737 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018737|OTTDARG00000015635|ZDB-GENE-030131-2165 nfyc|OTTDARP00000015816 nfyc-001 LG_none BX957244.15,CR388024.3 Danio rerio protein_coding KNOWN, 477 bp
GGCGGTAGGTGTTCGCGCTCCCCTCATCTCGGGGCTTTGA
ACACAGTGGAAGATCGACTGTCCCACACAGCCTTTTGTCT
CCTCCTGGGACAGAGCCTGTGGACTAAAGACATTTATGAA
GACTTTTGAGATGCCCTCCTCCTTTTCTGGCATCCACAAC
ACCGCACATGAAGGGCATGGGCAGATCTGGAGATGTCGGC
AGACTCATTTGGAGCGGGTGGCAGCGATGCCCAGCAGAGC
TTACAGTCTTTTTGGCCCAGGGTGATGGAAGAGATCAGGA
ATCTTACTGTGAAGGATTTCCGTGTGCAAGAGCTTCCTCT
CGCTCGCATCAAGAAAATTATGAAACTGGATGAGGATGTG
AAGATGATCAGTGCCGAGGCGCCGGTGCTGTTTGCCAAAG
CGGCACAGATCTTCATCACAGAGCTCACTCTCAGAGCCTG
GATCCACACCGAGGACAACAAACGCCGCACACTACAG

nfyc TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nfyc-001 477
nfyc-201 (1) 389
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nfyc-001 Contained in:
OTHER nfyc-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018737 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK147674 (1) 796bp
    GenBank:CD281218 (1) 673bp
    CITATIONS (1)