header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3978
Transcript Name: si:dkey-150k17.2-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017994 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017994|OTTDARG00000015034|ZDB-GENE-060503-806 si:dkey-150k17.2|no_translation DKEY-150K17.2-001 LG_ BX957317.12 Danio rerio antisense NOVEL, 4978 bp
CTGGTGTGCGTCTGCTCCACCATAGCCAGGGACAGATGGC
CAGCCTGCTACACTTACGATTATTTACTTTAGCAGTTACA
CCTCAGGAACACACCAGGCCACACGACCATTATTTTCTCC
AGTGGGATAAACTTGCTTGTGGTGAGGTCACCCAGATAAC
TTGTTTAGAGGAGCCAAAACGGTTACAGCCAATTGTCCAG
CTCAGCAGATTATTTCCCCCTGGAGCAGAACACTGAGGCT
CGCTTCCATTTTCCTGTCTGTTGGAGTTCAAGAGGACGCA
TCACTGGCTGAACAGAGGAGAACGTGACATTTGAAGGATG
AGAGGCTCTTTTCATACTGGCAACCGGAAACTTGCAAGCC
TTTTTCATTTCACTGATGCACTTCATAGGGGAAGAAGAAA
GAAAAGAGTTGCAGAAAGAAAGAACAGTGCACAAATGCAC
TAAACTATAGTTCCTTTAGGGGTGCATCCGCTTGTGGAAC
ATTGAAGCTTATAGAAGTACCTAAAGGCTATAGTTTGCTA
CAATTTAAGGTCCTAAAATGTACCTTTTAAGGTTTGAGAA
GATACAAAGTTGCCACAGTGGCACATTGTTGTATCCCTAA
AGGTATGTTTTGCAAATTTTGTGTGAACAGTATAAAAAGG
AAGTTTGAAAGCGAGACAGAAATGAAAAACTAATCTAAAA
TGGAGATGGCTGAAGGGCAAGTAAGATGCATACTGGCTGC
TTTTCCCTCAAACAATCTCCCTTTATCCTGTTTATTAATC
AATACTGCCACTGTTTCCACCCGGCAGCAGAGTTGTGTGT
AGCAGACGGCTAAGACGGGGTTTTCAGGTGGCACGCCACA
CCAAAAACTTCCCAGCATCCCTTCTGCTCAGCAAATGATG
ACGCATCATTCTGCTGACACAAGTCACCTGATTGCTGTGT
CACGGCAGTGGTTTTAGGCGAGTGGCAGCGCTCTGGCTAC
AGACGTAGAGTCTTTTTTTTCCTCCCAGACGCACTGCGGC
ACAGCCAGACGACTAGAGTGGAAGCACAGGAGCTCACAGC
TGCAGTCGACTGGCTTGTTTCGGGGAGGCTTCCTTTCGAA
ATACAGTCGCTGTGCTTCTCTCCGCCGTTAAAGGATCATT
TTCATCGGGGCAGAGCAATCAAAGAGAGTAGAGCCAAGAA
AGAAGACAAACTTTGAGTCAAGCAACTTGGAATTACGCTC
CGTCTCTGAAATTTAGGATAAGCAAGTCCAGATTGTGATT
TTTGTCTTGTTTTGGACTGCTTATGCCAGCATCTTCATCT
CCAGACCAGGATTCCAAGCTGCGAAGTCGGCGATAAAGGA
TTGCAGTGCGTCACCTGTCTGTCCCGTTATAAACCTGTCC
CATTCGAGTCGTCCAGTCAGCCGGGCCCACTTGCAATCCC
ACACACGGCGACCAGCCAAAGTGACCACTCTGCTCCAAGG
TTAAGGTGGTTTTCAATCCTAGACATAGTCCTTGTCCAGA
GGGCAGGGCAGAGTCAAACAGAAGCAGCGACGCAGCAGCT
GAGCTGAGCTCAGCCAGACAGACGCGGTGACCTAAATCAG
CCCCAGTCATGTCTGGACGCAGCCAAAGCCAGAGAGACGA
AGAGGAAAACGAGCGAGAGAGGCAGAGCGCAACCCACACG
TACTGACTTCAACATATACACGCACTATGGGATGGAGAGA
AATGGAGGAGGCTGTAAGGGGAGGGGGAGACAGAGTTGTC
TCTCTCTCCCTCTCTCGCTCTTTTCTCCACCGCTTTATTT
CGTTCATGTTCACAGCGCTGATCTTCACCGTTGCTGCAGA
GCGAAACGTAGAGTCGTGTCCCACTCAACCTCCCCCGTTT
GCACTTTTGGGTACAGTAAACGGTGGGATAAAAGACGGGC
TGAAGTGAGTTGGTCAGACGGGCCTTGCCAAACCCACAGG
CTGTTTCTGCCGCTCTGCTACCGCTGCGCTGTTTTTGATG
TGAGCCACAGTGCAGATGCAGTGTTTTTTGGGCGATCACC
AATAAGCTACCGTACTGGAGGAGATGCTGGTAAAGTACGG
GAGACCTTTCAAGAAAGCGAATGCTGCTCCGGTGTGTCAT
AGTCTAAGAGGGATGCTTGGAGGATGAAGGAAAATCCAGT
TTTTCTGTCAATGGAAAAAAAGCGAATGCTGGTCTGGTGT
GCCAATATTCGTGAGGGATGTTTGGAGGTTGAATGGGAAA
CCCAGTTTTTCTGTCATTGGAGAGTATGTGAATGCCTAAA
TGTAAACATTTATGTTGTTGGGGAACTTTCTGGAAACTTT
TGTAATTTGTTGCTCCCCAAAGTGTGGGATGTTATTTAAA
GACTCGATATACTTCAAACAAAATCAAAGAATGAATTGAA
ATGACGTCATTTTGAATAAAATCTGTGTGAATAGCCAATA
TTTTTGAGTTCTTTTCAGCAGTTTGAAACAGCTCATCAAA
GTACATTTTAAGGAGAATTAATTTTGGCTTTTAAACACAT
TTTAGCTACCATTGGTCTGTGGTGATTATGCATTCAGTGG
GCTTGTTCTTGATCTCTGCCTTCTTAAACATGCGATATCT
TCCCCGGGATTTGTTACTTATTCCACGGGGGTCGGAAAGG
AGACCAACATCTAAAATAACAACACAAGCTACAGTACATA
AATACACTGGAGAGTCGAGTAGCAGAACTGGTACAGATGT
ATCCGCACCAGTATGTCTGCTCACAGAGGGATGCCCACCT
TGCCACGTCACATCTTTTTTATGAGTTTGTGCACACCAGC
TTTACATTTAGTGTCTGTTCGCAACTAGTAGAAAAGAATG
TAAAGATATGATGTGCCAGATATTTATGAAACTGTTCCAT
TGTTGTGAGTACACATAAGCAGCACATTTAAAAACCCTGC
CTACTGCAGCGGGAGCGTGTTGGAGTGTAAAAATATACAC
TTTTTTTTTTATTACACTAAAACTATAACTCATGAGATAG
CCATTTTGATATTTTTGTAATTTAAAGGTCCCGTGAAATT
AAAATTAAGTTTTTTAGATGTTAGTTTCAGTTTGTTAATT
TTAAAGGATATCTATGAGCTAGCGTGTCCCAAAACAGTGA
CAAAATTCGTGTTTAGAACATATAAACATCCAAAGTTTGT
AGTTTGTCACTTCCGCCTGAATCGTCAAGGATTTTTTCAC
ATCACCTCATACTTCAGTTTTTCATCAAATCTGGCCAATC
AAATGCTCTGTAGCATCGGTCATGCCTACCCCCTTCAAGA
CGCTTCTCATTTGATTTAATGCACTTTCTGGGAGAGCTGT
CATAAAAACAAAATGATATTTTTTTTGGCGCTTTTTTCTT
GAAAGAGGAGAAGCTACTTTTTGCCCATTCTTCATTTTTC
AGTTGTAATTACATCAAACACAGAATAAAAATGCACATTT
CAAAGCACTTTACGGGACTTTTAATAACTTTAAATGAAAT
TTTATTTATTTAATTACAGTACCCCGACTGTGTGTATATT
TATTTTATACATAGTTATTTTGATAAAGTTTTAAAACGCA
AAAAAGTTCTGAGTATTTCTACCTTCAATGGCAATGACAG
TCACATTGACCGCATGCATTTCAGCATCTGCTACTTTTAC
CATTGTATGTGTGCTTCTGTTGCCTAGCAACTTTCTGCTA
ACAAAAATATTACTTTCTGATAGCAAAAACAAAACTTTAC
TTTAGACATGTCTTGCAAACATTTTAAAACAACGTTTTCA
CCGGAGTGAAAAATCTTTGCTTTCCTGCTTGCCAGACAAT
GTAAGGTACACACCTTCAGGGGGGTCAAGCAACTTGTGCA
CAGTTTTAGATAGGTATATTGACCATACAATATGATGACA
GATATTCAAAGCTTAGTTCTAAGATTTCAATAGAAGCTTC
AAATGTAAATTACAAAAAAAAAGAAAAATAATAATAATAA
ATAAATAAATAAAAAATAAAATAATAATAAATAAATAAAT
AAATTTGGTACAGTCTTTTATGAATGGTCATGTATACTGC
ATATATATGAATTGTATATGACTGGTATGAATGGTAATTC
CAGTGTTTAAGCGGATAAAATACTGACAGTATACTAGTAG
ATTGCAAAAAGTAGATCACTATTGAATGACACAAAAATTA
AAACTCATTATTTATTCTTTTTGTTCAAACCCCTATTTAA
CTGACTTGTTATCAATTATATGGATTACATTTCAGAATAA
CATTTTATAGAAGGATAAAAGACATTAATCAATGATGTAA
TTTATCATTTTTAATTATCGATTTGTGTGGGTGTGACAAA
TGATCCACTACCAGCCGCATTTATTTGATCATAATACATC
ACTAAGCAGTGGTGTTGTGAAATGTAGTTACACTGTAAAA
TAATGTTTTATATTTGAATATATGTTAGAAATTATTAATT
ATTAAATGACTAATTTATCAATAATATTGAATTTCCAGCA
TTATTAATCAATTTTAAATGATCTTTGATGAGACATTATG
CTATTATGCTGATTTGAGGCTGAAAAAAAATCCTAAAATC
ATCAACGCTAAATGATTATTTCACCCAAAACCCAACAAAT
AATTTACTCACACTTCACGTTTTACAAATTTCTTTCTTCT
GTTAAACAATAGAGGACATTTTAAAAATAGAATTTTGATG
TCAGAAACTGGTTACCATTGGCTTCCTTAGTATTTGTTTT
TCCTATGGATGTCAATTGGTTACCAGTTTATAAGATTCTT
CAAATATCTTTTGTGTGTGTTAAACAGAAGAAAATGTTTT
GAAACCACTTGAAGATGAGAAAATAGTCAGTCAAATTTCA
TTTGTTTTGTTAAACTCTCTTTTTAAAAACAGTATATATA
TATTCATATTTTTTTATGTGGAAACTGTGGCAGTGTATAT
CTGTTGTATATCTGTGTATATCTGTTGTTTTTGAATTTTT
ACATATCAACCTCAATCCATTTACTGAACACAGTAAAACA
CTTTGTGAAGTACTTCAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-150k17.2-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000017994 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH434081 (1) 963 bp
GenBank:EH457384 (1) 957 bp
GenBank:EE202739 (1) 491 bp
CITATIONS (1)