header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3705
Transcript Name: tshz1-202
Previous Name: tshz1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017238 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017238|OTTDARG00000014427|ZDB-GENE-030820-3 tshz1|OTTDARP00000014600 tshz1-001 LG_ BX470238.6 Danio rerio protein_coding KNOWN, 8757 bp
TCAGTAAAAGCCTTCTCTTTATTATTTTTTTCTATTATAT
ATTCTTAGTTTTCGCCTGTCAATGACTGTACAAAATTCAT
TTGACCCAGTCGCTGATTGAAGCTGGAAGTTTTATGTAGT
ATAAAATAGTTTTTTTTTATCAAGAGCTTCAAATCTCCTC
AGTTTGAGAAGTGTCTCCTGCTTTTATGACAAAAGGAAAA
TCTCTATGAAGGAATAATTGTGATAAAAAAAAAAAAAGAT
TTCTGACTTGACTAATATAAAACCTGCTCACTCTCTGTCT
CTTTTATTTTTTTAAATACACTGTCATCCTATTAACAATT
AAAAACTGATTTTATTTCAAACTTTAAATGATACAAAAAA
GACAATTTCATCAACTATTGTTTATTTGCATTATTAAATA
AATATCAAAACATTCAAACGATTTGAACGAACATTTATTA
AATAAATAAAGACTAATGTACATACACAATATGACATTAA
AAAAATAATTAATCAGAAGCTCCTAAATCAGCAACAACAA
CAGCTGATCAAGAGCTGTAATTGTAATACTAAATATATAC
TTCAACGTTTAAGTGATCGTAGAGATCCAGTAATATAATT
TTAATAAACATAATTGCAGTAGTGGCATGTAAAATGGCTT
TGATCATGATCGCAGATGTAAGGTTACACCACACAGCCGG
TCTGGAGTATTATTACCGCTATTTGGATAGCCGTGTTGAG
GTGAACAGTTATAATTTTAGCAATACTGACGTTAATACCC
ATACGATCATCACTATCAATAGCTGAACAGCTTCATTCGT
TGTAAACAAATGAGAATTATTTAAAAGTGGTATTCGAAAT
GCAAGTTTTGCTGACCTCTGACCCGTGGACTGCAATATCG
TCCTATTTGCAGAACAGCAACATCACCTACAAGACAAGAA
CAAGATTTTGGAAGCATAATCAATACGTGTGCATCACATG
CGAGGTATAATACTTTCACAAGATTTACAGAGCAAACCTA
TTTCTGTAACCCCCACGGGGGAGATATGTTGCTGGAAATA
CGCTGGATCGTGTAATTGGTATTTATCTTGCCTGCTGGTT
TTGTGAAATACATGATTATTAAAAAAAAGAATACTTGAAA
TGCAGACATTTGCATAAAACATAACGCAGATTTTTTAAAA
AGAATGGTGTAATTGCTTGTAAATGTTTCTTTTTTAATGT
GACTATTTACATGCCTGAAATGCACAGTCTGGGATTATAA
TTCATGTACACACACACACACGACAACAGTATGATCAAAT
CCTTTTTTTTTTTTTTTTACACACTTTTTTTTGACATTTT
GACAGTCTAGAGTACATCTACTCAAAAATACAACAGCGAC
AGCGTGCTATGTTATTGTTTATAAACCTTCAGATCTCGCC
ATACATATCTGCGGACACATATGACGGCATCCCGCCTCGT
GTAGCGTGTGGGCAATTTGGATCATAATTTGTTGATGTGA
TGTGACATGCTACACATAAAAAAAATAAGTACTTCAAAGA
CTATCACCTCAAATCTCCCTCGGTTTTTCAGTTCCAGTCT
TGTACCATCCGTCTGCGATCCCTTAAGCAGACAGCCTCAT
ATTGAGACATACTTCCACAACATATAATGTGCGTTATAGC
ATGTCCTGGTATTTTAATGCAAATAGGGCCATTTTAATCT
ATAGCAAATAGAAGATCAGACTGAAAAGCGTATAAATTTG
AGGGTATTTTCAAATCTATTTGCTGTCAGTCATTATAAAG
TATCAGCACATGAACATACAGATACTATAATATACAGTAC
ATAATCCCATCTATGATAAGAACTTAAATACTTTAGGCTG
GTAATTTAATAATGTAAACAGATTTCCAAATGCATTAAGT
GCAGGACGATTCATTTTATTTTCCTTTTTCACACAATATA
CTTAAATGCTCACATCACCTCCAGTCATTCAGTTAAAAAA
AAAAAAAGAAACACAGAACTTACGAGGGAAAGACAAACAC
AAGTATTTCTCCCATTGGAGCTCTAACTAGAACTGTAAGG
CTGAAAATGGCACAGTTCAGATGCCACGCGAACCTTTCAA
AGTGCGTTGGCATTGCATCTTGAGCTTTACGCTTGTGCTT
GCATGGCATACCTTCAGGCATGGCCTTTTACAAAAGAATA
CGATGTTCTACACCGAATAAGATGATAGGTACACACAAAC
ATTTATACATTATATATGGATAACAATTCCCAAAACACAC
ATAAAACAAACACACACACACACACACACACTAGCATACG
CCAAGCTGTCAACACTAACTAATGCTCACTACCAAAATTT
GTGTTGCCAATGATTTGTGCTGGCACATAATAATAGAAAT
ATAAATTGCATAAATAAATGGGTTGCTTTGTTATTTTTTT
CAAGATGCATCTACTATTTTAAGTCAAGTTTATTTCCGTA
GCTCTTTATACAGTACAAGCTGTGTCAAAGCAGCTGTACA
GAGATCAACAGGAAAAAAAGTACATTCTATTATGGAAACT
AAACAATGGAGGCAATTCAGATTCTGCATTAAAGCAGCTC
TAAAAGACAACAGTGTCATCATTTAGCTCAAGTGAGACAT
TATTATGTGTTGATTCAGTTCTATAACACATGGAAAAGCC
TGTAATTATTTGTATTGTTATTAATATAAAATTATATGAG
CACAGCTGGATAATTCACCATGCCTAAATAGACTCGTCTG
GGTTTTTGGAGAATGAGATGAAACCCAGCAGGATCTGGAT
TTTTTCTTTTTCTTTTTTGAGGCATCATATTATTTTGTTT
ACCCTTACAATAACTGTAAATGTTACAGTGAACTTACAGT
GAGCAACATATTTAAGATGTACTAATTTACTTGCTGTTTT
TGTAAACACTTATAAGAATATGTTTAGTACTGTAAAGCTG
TCTTAAATCTTTTTAGGGCACTTAAATACATTGAAGGGAA
CTTAATGACGATGTTACATATCATATGAAATGCTGCAAGA
ACTGCTCCAAACATAAACGAAGGGGGAAAACACTGACTTT
AAAGTCTTATTATGATAGAGCTAATAATCCAATAGAGGCA
TTCATTTCGGGAGAGTGCGAGTGGATTTCCATGGGACAGA
AACTGTCACGAGTGCACGAATTGAATCTACAAATGTGCTC
TAATGCGATTTTCACGATGAAAATAAGAATCAACTAAATC
GATCAAAATATAAAATAATAAATCTAACAGTCATTACTAT
CATTAGATGTAGAAAATACGATTTAATCAAAGTTGATGCC
TGTTAGAAAACGCACAGAAATCTCTTTCCATCTCAAGATG
ACAGGCTAATTATGATTGTACCCTTCTTGCTGTAGGAGAC
CGAAAGAGATCTGTTGTTAACCCGCAAAAATCGCGGAAAA
CAGTAGCGTTTTAAGAAAACGAGGCTCGTGCCCTACAGCG
GGAGCAATCTTGGCTTCTTTGAGCCCGATGAGTTTCTGAT
GGGAGATTGGTGACGTAAGAGCCATCAACAGCGACAGGCT
GATCGAGGTAGTCGCGAGGATGGATAGATGGACAGATGTT
GGGGCGGAACTTGGACATATTTCCACATTATTAGCCCCTA
CCGACAGGCGTACGGCATAAATGATCAGTTAGATTGCAAC
TGGCAGTGGCTCAAGGATGCGCAGAAGCGTCAAAGGCTTT
CCACCGAGCGCGAGGACGGAAATACAGTTGGACGGGCTCT
CCATAACTGGAAGTTTCTTCCGTTTTGCTACAAACTATTG
CCATAATCCAAGGAGAACCTAAGGAAGCGTTTTTCTGCGC
CGTTAGACATGGACGGGAGATATATCTGTGATCTTGGCAA
TCATGCTCTGACTTCCAGTCATTAAACGTGTCGGCCAGAT
ACACCTATATTTTCTTTTTATTTATTTGCAGGCGTTTTTA
GTCTGTAAAAGCAATCTACAACCTCTCAAGACCTATTGAC
CCCTCTTAGACTTTGCATCGGCTCAAAGTGACTTTTTAAA
GAGGTGGAATAAAGGGACTCTGAGGAGAAGAGGAGCGCCG
TAAATACACACTTGTATTACATTTTTTAAAATTAATTCTT
TTCCCCTGTCACTGGCATTTTGGTTCTGTATGAGAAGTCA
AGTGGAGGGTGGGACGACAGCATGCCGCGGAGAAAGCAGC
AAGCGCCGAGGCGATCTTCAGCCTATGTGCCGGAGGACGA
GCTTAAGGCAGCTAAGATCGATGAGGAGCACCTGCAGGAT
GACGGACTCTCCTTAGACGGTCAGGATGCAGAGTACCTGT
GCAATGAAGAAGACGATGGGCGTGAACAGCTGAGCTACCA
GAACTCTCCACTCAGCAATGGCACCAACCCAGATGCTGGG
TATGGCTCACCCCTTAGCGACACCAGCGATCACCTGGCTG
ACTTTAAAAGCACCTCCTCCAAAGAGGGCCAGGATAAAGA
GGAGGTTGAAGACATGGACACGGATGCCAAACTATCATTG
CAGGATAGCCTGGCACAGATGAAAGCAGTCTATGCAAACT
TGATTTCAGATGCTTCCTGGTCGAGCATTACAAAGGACAT
TATGAAAAGCAAGCAGGTTAGTGCTAGTAGCATTAACAGT
ACTTCAAGCAGCCACAAGGGGAACAACAGCGTCGCGAACA
GCCATGCAAGTACCATTGCAAGTAGCGGAGCTAGCAGCAG
CAGCAACGCTAGTGCTAGCACAAAGACAAACGTGACACAG
AGCAGCAATTCTACAAAAGCCACCACATTAACCAATGCCA
ACAATGGAACCATCAATGGTGCTAACAGTGGGGGTGTTGC
ATATGACTGGCACCAAGCAGCACTTGCTAAAACCTTACAG
CATACGCCCTACCACTTAATGCCTGAACCAAGTCTCTTCA
GCACAGTGCAGCTGTACCGGCAAAACAATAAGCTGTATGG
GCCTGTGTTTACAGGTGCCAGCAAATTCAGATGCAAGGAC
TGTAGTGCAGCCTACGACACGCTTGTAGGTCTCACGGTAC
ACATGAATGAAACAGGTCATTACCGTGATGATAACAAGGA
CAAGGAGGAGGACAGGGGCAAAAAATGGTCTAAGCCAAGG
AAGCGATCCTTAATGGAGATGGAGGGTAAAGAAGATGCAC
AGAAAGTTTTGAAATGCATGTATTGTGGCCACTCGTTTGA
ATCCCTACAAGACTTGAGTGTCCACATGATCAAAACTAAA
CACTACCAGAAAGTGCCTCTAAAAGAACCAATGCCAGCTC
TTGCCTCAAAGCTGGTGCCCTCCACCAAAAAGCGAGTGTT
CCAGGACCTGATGTCTCCATGCTCACCTGACTCAATCTCT
AGCACCCCTGGCATTCCATTAGCTGAGACTGCACCCACCA
AAGATCCAAAAATTTCAAATCCATACGTCACGGCTAATAA
CCGTTATGGCTACCAAAATGGTGCAAGTTATACCTGGCAG
TTTGAGGCCAGAAAAGCTCAAATTCTCAAGTGTATGGAAT
GTGGGAGTTCCCATGACACCTTGCAGCAGTTGACAGCCCA
CATGATGGTGACCGGTCATTTTCTAAAAGTCACAAACTCT
GCATCAAAAAAGGGAAAGCAGTTAGTGTTTGACCCGGTGG
TGGAAGAGAAAATCCAATCCATTCCTCTTCCACCCACAAC
AACACGCTTACCAGCTCCTGCTATCAAGTCCCAACCAGAC
TCTCCAATACACCCCTCCATTATGGATGATCGGAAGGAGT
TGGAAGAAGAGAAATTTGAGGAACCTGAGGAAAAGAAAAT
CAAGCAAGAGAAGGAAGACCCTTCTGAGAGGGTTGAAAAG
TCTGAGAAACTCAGCCATTACAAATATCTTCGAGAAGAGG
ATCTTGAAGAGTCTCCTAAAGGTGGCCTAGATATTCTCAA
GTCATTAGAAAATACAGTCTCCAGTGCAATCAGTAAGGCT
CAGACCGGTACACCCACCTGGGGTGGATATCCCAGCATTC
ATGCTGCCTACCAGCTCCAAGGGTCTGTGAAATCATCTAT
ACCTGCTATCCAGAGTGTCCAGATTCAACCAACATTCAAT
GCCAGCAGCTTAAAATCTTTGACCTCTGACTCCAGCACTC
TGATACATTCTCCTAGCAGCCCATCACCACCACCAAACCA
TAAAAGCAATGTCCTAGCCATGGAGGAGTTGGTGGAGAAA
GTGACAGGGAAAATTCCATCAAAGAAAGACAGGGATGAAA
AATTAACTGAACGTAATTCCAAACATCTTACTGCTGAATT
ACCCTCTCCGGTTCTCAAAGAGAGAAAAGACCTGCCAAAA
CCAGATGATCTTACTAAGCCAACAAAGAATGGCACTGTAG
ATAAAGACCTAGAGCACACTCCAGTTCGAGAAGGAGAATA
CAAGGAAAGCCATGCAGATAATCCCATAAAAAATGGAACG
GATGCCCTCAAAACGCAAGTCAGCAATGGTTGCGGTAATT
TAGGAATCATCACTGACCACTCACCAGAGCAGCCTTTAGT
TAACCCCCTCAGTGCATTGCAGTCTATCATGAACACTCAT
TTGGGTAAGGCTTCCAAAACAGTCAGTCCACTCCTGGACC
CCTTAGCAATGTTGTACAAGATTAGCAACAACATGATGGA
AAAACCCATGTACAATCCAGCTCAGGTCAAACAAGTGGAG
CCCATCAACAGATATTATGAAAATGACGACGATCAGCCCA
TGGACTTGACAAAGTCCAAAAGTGGCATTGGCCCCACAAA
TAACTGTACATCCACCATTATAAGCAACAGCAGCATCACA
AACAGCACCCGACCCATCTTATCCACGTTGGCTGAACAAG
TCTCATCTCCTCTTCGGGAGAATGCCCTAATGGACATCTC
TGACATGGTAAAGAACCTGACTGGTCGCTTGACACCAAAG
TCGTCAACACCTTCCTCTATATCAGAAAAGTCAGATGCAG
ATGGATGTGCTTTTGAGGATGGTCTGGAGGATCTTTCACC
TATTCAAAAGAGGAAAGGCAGGCAGTCAAACTGGAACCCT
CAGCATCTGCTGATTCTTCAAGCTCAGTTTGCATCCAGCC
TTCGAGAAACCCCTGACGGAAAGTACATAATTACAGACTT
AGGTCCTCAGGAGCGTGTACATATTTGTAAGTTTACAGGT
CTCTCTATGACCACCATCTCCCACTGGTTGGCGAACGTCA
AGTACCAACTCAGACGGACAGGTGGAACCAAGTTCCTGAA
GAACATAGACTCGGGCCATCCACTGTTCCTGTGTAGTGAT
TGTGCCTCCCAGTTTAGAACTCCCTCCACATACATTAACC
ACTTAGAGTCCCATTTGGGCTTTAGTTTGAAGGACCTCTC
AAAGTTATCAATAGACCTCATAAGAGACCAGCAAGCAGTC
ACAAAAATGATCACAGACAAGACATTCCGTGCCCTTGACT
TGAATGAGGAAGACTCTAATTCCATATTTCAGTGCAAACT
GTGCAATAGGACTTTTGTCAGCAAGCACGCAGTGAAACTG
CACCTCAGCAAAACACACGGGAAGTCACCGGAGGACCACC
TGATCTTTGTTACTGAGCTGGAAAAGTTAGAAAAAGCCTA
AGGAAAGCAGGCTGGTGGCAGTGAAGTGACTGAATTGAGA
ATCATTGCACTACATCACTGTACTGCACTGCGCCTGAACT
GAGCCTTCAAAATCAGTCCAACTTGTCGTGAAACTGCCTG
ATTGGACCATGATCTGTTTCAGTTTTTTTTTCTTCCTCGT
TGTTTTCAGTCTCTTTGTTTCTATCTCTTGCTTTGTACTG
TATTTATCTAATACGTGTTGGTTATGTGCATGTTCTGTTT
TTTTAAACCTTTTCTTTCTTTCTGAGTGACTTTACATTCA
AACAGAATTTACAATTTGTACTCTGTTGAATTGGGAATGA
AACAAACATGGTATCCATGGGCATGGTCTAAAACAAAATG
GCAAAAGAACTTCTGAACAGAACGATTTGCATTGTACTGA
ACACTTACTATGTCAAAAAAAAGACTGACTTCATTAAAGC
ACTCTGTAGTGTTGAATGTTATGAGAATATGTATAAAATG
AGACAGAGCTATTTTGTTAATTTGAGCTCCGATTTTTAGA
TATTGGCTTGACATAAATCAAACTGCAACCCTTTGAAGTG
AAAACAGTGCATTGTAGATTTTGTTGAGTCTTCTAAACCT
CGAAGGATATTGGAGATTTTGACGGGCTGCCTCTGATTAT
ACACTTTGGTTTTTTCAAAGACATTTCTTTGTTTTTAATC
ATTGTTTTTTGTTTGTTATTGTTAAGTATCATTTTATACA
GTAGCAATTTGAAACGTATGCTTTGGTACCACTATTCCTC
TTTCTATGGTTTGGCTTCAGATTCAACCTGTAAAGACTTA
ATTGAAATCTTATATACAGCACATATATTTAAATGATCAG
CGAAGATGTGTAAATTTCCATCGTCATATCTTGCCAATTG
CCGCAGCTCGACATTGTTTGTATGGTGTGCATTCTTTTAT
ATTATCATTTTATATATAGTAAACGAAAAGGAAATAATAT
GTACAGAGATGTATATGCAGTATATGTGCTGTAGAACCAC
GATTCATCCTTTAGTTGAACTAAGTTCTCTGATGTGGTAA
ATATGACTTGACTGAAGGAGTTGCATCGCTGTCGATGCAT
GGCATACGAGTTGGAACCAAGCAATGCAAAACATGAAATA
CAGTACATTTCAATGTTTTCTCATGCCATTGTGAAAAGTC
CCATCGATTCCCTTAATGAAAAAAGAAAAAAGGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tshz1-202 Contained in:
OTHER tshz1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017238 (1)
  • Ensembl_Trans:ENSDART00000122002 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC163536 (1) 4241bp
    GenBank:AF242292 (1) 3754bp
    CITATIONS (2)