header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-37
Transcript Name: znf511-201
Previous Name: znf511-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002025 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002025|OTTDARG00000001897|ZDB-GENE-030616-621 znf511|OTTDARP00000001782 CH211-217G15.6-001 LG_ AL831745.3 Danio rerio protein_coding NOVEL, 951 bp
ATATTTAATAACATATAATGTTGCAACCCGAAATAATTGA
ATTTTTGGCCTCTACTACACCACAAATTCTGGCAAAGAAC
ATACCGGTAACTGAAAACAGGGAATCCAAGAGGCATGATA
TACAACAAAAAGCCGAAGCTGGAGAAGAAAAAGCTGTATC
ACCTTTTGAATTCAGACCTCAACGACTTCGATTTGCTGTG
GAAGATGAATATTTTGAGGATGGCGACATAAACAGACACA
TGTACCTACAGAATATCGTGACGTCATTTGTGGATGACAA
ACAGCCTCCAACTATCTCTGAGTTCAGGTGTCACATTGCA
GGATGCAAACAATTATTCGACACACTGGAAGGATATGAGC
ACCACTACAATGCATTACATCGAAACGTGTGCTCCAACTG
TAAGCGATCGTTTCCATCAAATCGCCTGCTGGAGATCCAC
ATATTGGAGTGGCATGACTCTCTCTTCCAGATCATGGCGG
AGAAACAATGCATGTATGAGTGCTTGGTTGAAGGATGTGG
ACTGAAATTCAAAACGAGCAAAGAAAGGAAAGATCATCTA
ATCAGAACGCATAGCTATCCAGCGGACTTCAGATTTGACA
AGTCAAAGAAGATCGGAAGAACAACAGAAAAAAAGACTCA
ACAGAAGAAGGATGCACATATGGAAGTTTCTGCAACCGTT
CTGCAACAAGAAAGCTCTGAGTCCATGGATTTTTCGCTGA
CCCCAGAGCCTGTGGAAACAGAACCAATGCAGGCAGCTAA
TCTAAAACCACGATACTCATACAAAGTTCCATCATCCATT
TGTTTCGGTCAAGGCTCAGTCAGAGGCTTCAGAGGAAGGA
GGAAGAAATAGGCCAAAGCTTTTCTTCATCGCTAACAGCT
CACCACATGAGCTCAGTAAAGCATTTGTTTGTTGAGAGCT
GTATTTTTATAATAAAAATCATGAAAGCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf511-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000002025 (1),  Ensembl_Trans:ENSDART00000000831 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BI709799 (1) 577 bp
GenBank:BI708509 (1) 557 bp
CITATIONS (2)