Transcript

dot1l-202

ID
ZDB-TSCRIPT-090929-3581
Name
dot1l-202
Previous Names
  • dot1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016900 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016900|OTTDARG00000014160|ZDB-GENE-060503-341 dot1l|OTTDARP00000014326 DKEY-211F22.1-001 LG_ BX005098.11 Danio rerio protein_coding NOVEL, 3593 bp
ATGCCGTTACAATTGCAAACGAACACACAAAGAGATGTAT
GTCGAGATGCAATGATAAACCACACATCCCCATTTCAAAT
ATGTGACTATTCAAATTCAGATGAGATGGATAAACATCAT
GATGCTGCACACGAAATCATCGAAACCATTCGCTGGGTGT
GTGAAGAGATCCCAGATCTTAAGCTGGCCATGGAGAACTA
CGTTCTTATTGACTATGACACCAAGAGCTTCGAGAGTATG
CAGAGACTATGTGATAAGTACAACAGAGCCATCGACAGCA
TTCACCAACTGTGGAAAGGGACCACCCAGCCTATGAAACT
GAACAAGCGGCCTTCCAATGGCTTGCTGCGTCACATCCTG
CAGCAGGTCTACAACCACTCTGTCACCGACCCGGAAAAAC
TCAACAACTACGAGCCATTTTCTCCAGAGGTATACGGAGA
GACCTCCTTCGACCTGGTGGCTCAAATCATCGACGAGATG
GAGATGATGGAGGAAGACACCTTTGTGGATCTGGGCAGTG
GGGTCGGTCAGGTGGTCCTGCAAGTTGCTGCGGCCACCAA
TTGTAAACACTACTATGGCGTGGAGAAAGCAGACATTCCA
GCTACCTATGCAGAATCAATGGACAAAGAGTTTAAGAGGT
GGATGAAGTGGTATGGCAAAAAACATGGCGAGTACACGCT
GGAAAGGGGAGATTTCCTTTCAGAAGAATGGAAGGAACGA
ATAGCCAGTACAAGTGTTATTTTTGTGAATAACTTTGCCT
TTGGTCCTGAGGTGGACCACCAGTTGAAGGAACGATTCGC
CAACATGAAGGAAGGTGGAAAAATTGTTTCCTCTAAACCA
TTTGCACCTCTTAACTTCAGAATAAACAGCCGAAACTTGA
GTGATATTGGCACAATAATGCGAGTTGTGGAGCTGTCCCC
TCTGAGGGGTTCGGTGTCCTGGACAGGGAAGCCAGTCTCG
TACTATCTGCATACAATAGACCGCACCATACTTGAAAACT
ATTTTTCTAGTCTCAAAAATCCTAAACTCAGGGAGGAACA
GGAGGTTGCCAGAAGGCGCCCACAGAAGGACAGTAAAGAG
AACAAGAGCAACACCACCACCCCGACCAAGCCTAAAGAGC
ACAAGGCGCAGCATGATTCGGGTGGTGAAGAGGAGCCAGT
TGTCCCCGTGAAGCCGTCACCCAAACCCCGCCGGGCCAAA
ATTCTGACCAGGGGCCGCAAGCTTGGCAACAGGAAGCGCG
GGCGACCCAAGAAGGCACCAGCTGCAACTGCAGCCGAGCG
CAAGAACAAGAAGAGCCAGAGCGCCCTCGACCTGCTGCAC
GCCAAGACCCTCTCAGCGGCCCCTGCTCAGGAACCATACC
GGTCACCTCAGAGTCCGTTCTATCAGCTACCTCCCAAAGT
GCAGCATTACACATCCAGCCAGCTCCTCATGGCTCCCACT
CCACCTGGCCTGCAGACGCTACTGGATAACATCAAAGTCC
AGTACCTGCACTTCATGGCCTACATGAAGACGCCACAGTA
CCGCACCAACCTGCAGCAATCGCTTGAGCAGGAGAAGCTG
AGACACACAGAACTGTCAAGTCAAGCCCAGCAGCTGGTCA
ACGCTTGTCATGCTCACAAGGAGAGGATTCATGACCTTTT
CCAGTCCAAACTAGAAGAGCTGGGTGTGAAGGCGGTGACG
GTGGAGGATCTGGTTCAGGCTCAGAAGGAGATTACAGCCC
ACAACATGCAGCTGCGCGAACAGACCAAACAGCTGGAGCA
TGACATGGCCGAGCTCCGAGATCAGAGCCAGCTGCTGCTG
AAGGCTCGCTGTGAGGAGCTCAAGCTGGACACTCTGTGTT
GGGACACTCTGAAGAAAGAGATAGAAGCTCTGCGGAGACA
GATCTCTGAGAAACAGCGCCACTGTCTGGAGCTCCAGATC
AGTATAGTTGAACTCGAGAAGAGCCAGCGACAGCAGGAGC
TCCTTCAGCTCAAGTCATCCTACAGCCCTTGTGAAGTGTC
CCCCTACAGAAAAGCCCTCCCTGGCCCTGATCCTCGGCCC
ACACTGGACCCGGATACCCCAAAACTCACCCCGCAATCCT
CTATGGGGCTGAACGGCCTCAGTCCTGAACTCTCTATCAA
CGGCACTGCCTCTCCGGGTTATGAAAGATGCACCGGAAGT
GCAATGGGCAAAAACGAACTCCTCACCCACTACCTGCCCA
TTTCTCCAGACCACGAAATTGTGCCGCCAACCCCGGACTC
CAGAACCAGGCAGCTTGGGCAACCCCTGCCCGACTACACC
CGCTTTTCTCCAGCAAAGATCGCCCTCCGCAGGCACCTCA
ACCAGGATTCAGCCGCAAACCAGTTCCGGGCACTCGGAAA
CATCCATCGGGGCGACACTGGTGCCATTTCATCTCCAACA
CTGGGCTTTAAACAGGCTTCACCATGTTCCTCGGAAGTTC
AAGCGGTCACCACAGCCAAGAGCACAGATAGGGCCGATAA
AGAAAAGAGCCCGACTGCACCCGGCGACACTATAACCAGT
CTACCAATCAGCATCCCTCTCAGCACTGTGCATCCCAGCA
AACTTCCTGTCAGCATCCCTCTGGCCAGTGTGGTGCTGCC
GAACCGCGTCGAAAGACTGAGGAGCACTCTTAGTCCGCCC
CGCGGCTCTGGCCTCAGTCCTCCACTGGGCACCGGAGGCG
TTCTCCAGTACGCCGACGGTCCACCAAGGCTTCCCCCCGA
GGATGGCCATGAGCGCCAAGGCCCCGAATCCGACACAGAG
CCCTTAGATAGTGAGGCTCGCCGGCGCATTTTTTTCTCTT
CATCCTCCTCTTCTTCCTCATCCTCATCCTCCACTGGAGG
CTCGAGGCTGCACCATGGGTCTGTAAAGCAGGGTCACCAT
CATCACAGTAAGCACCATCACCACCACCACCACCATCATC
ACCATCACTCTCCAAGCTCCCACAGCCAAGAGGGCCGAAA
ACGAGGAAGACGAAAGCGCAGCTCATCTGGAGCCGTGCCC
ATGAGTGGATCCCCCAAAAGAAGGGTCTTTCCTGGACTGG
GCTGCTCAAGTCATTCCTCTGGATCACCGCTTAATATCAA
TTCAATGGTAAACAACATAAACCAGCCTTTGGAGATCTCC
GCCATTTCTTCCCCAGAGCAGTCAGGCAGAAGCCCATGTG
AGCAAGATCTGGATCAGCCACCTGTTTTGAAACGAGAGCG
TCCTCTTGAGCTCAACAACACCGGCCGTTATTCCTCTGCC
CCAAGTTCAGATGAAGAAGGCAATGGTTACGCCCCGGACA
CCTCTAGTTCAAGCCGAATTGAACGAAAAATTGCTACTAT
TTCCTTAGACCGAGATGGACCAGTTAGAGACTTGGAAAGA
GGGACGTAAATCAGGTGCCAGCAGCGTGAGCAGCGAGGTA
TCCTCTTCCTCCGGAACCAGCAAGTGGAAATCCACCTTCT
CCCCCATTTCTGATCCCAAGCCAACTCCTCCAGACATCCG
CCAAGGTGGCTCACCATTTAGCGTTGGAGCTTCCCGAGGA
GGCACAGACTCAGACTCGGACCACAAACCCCAGAGGAGAG
GGGAGCGTGAGCGTGAGCCTTATGGAAATTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations