ZFIN ID: ZDB-TSCRIPT-090929-3570
Transcript Name: si:dkeyp-113d7.1-202
Previous Name: si:dkeyp-113d7.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016882 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016882|OTTDARG00000014150|ZDB-GENE-030131-755 si:dkeyp-113d7.1|OTTDARP00000014311 DKEYP-113D7.1-001 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 2517 bp
CGCGATATTTATTAATCCACTTCTCTCTGAAGTGCCCGAG
CATTTGATGTTTAGCTTTTGTCACGAAGCTTATCCTCAGG
GTGATGTATGAAGATAGCATTTAAACGAGGCGAAGAACAT
CTGGCAGCACAAAACACTGTTATCTTAGTCCGTGCAGATG
TTTATTTCATTTCCCCTCAGAGTCCTCCGATAAAAAAAAA
ACGCGCATTTGTCGGAAGTAAACAAAGTAGGAGCTTAGTA
AAAAGCCGAAGCTGCGCGCGCATTTACATTTTTACGACGG
AAGTGGAACGGCTGAAACCCGGAGGAAAGCGACAACGGGA
GTGAAAACGAAGCGGAATTAGTCAATGAGAGGGAGGAGAG
AGAGAAGGAGAAGGAGTGTGTGCGACAGGGAGGCTGCTGG
ACGCTGGGGCCGAGGTGGACGTGGCGGGTCCGGTAGGGGT
TTGATGTGGGTTTTGCTAACGGCGCGTTGACGGCCGAAAA
AAAGGCAATGAACAGGAGCCAGGGGACTCACGGTTGTTCC
TAACCCAGGACAGAGGTTGCCGTGGCAGCAGTGACAATCC
CCACTCAGGAACCCCACTTTTATCTCTGAAAGTAAGGTAT
CGTCCTCATAACGGAAGCTTCGGTCAGACGGTGGACTCGC
TTCCACCAGGATGGCGGAGTTGGAGACAGAATGCATCACT
TTAGGACTAAATAATTTAGTGTCTGAATGCGGCACTCCTC
CACATGACCCTTTACACTCGGATTGTGGCACGCCGACCCT
GACCATGCTGTCGTCAGAATGTAGCACCCCCACGCTCAGC
TCACTGGCCTCGGAGATTGTGGAGCCCATGGCCATGCTGC
CGTGCATCAAAAGCGAGCCGGACCTGGACCCCATACGCAC
CGTGGATCTGTCAGTGATCCAGCCCCTGAGCACGGCCGAG
CTGGGCTCCGATCAGATCAAAATGGAAATCAGCGGCCTCG
ACTACATTAAATCCGAGCACCACAGCGACCTCAATTCCTT
TCACAGCACGGAGCTGGACTCCTATAAGTCACACTATGAA
CCCAGTCTGGTGTTCGATTACATTAGCCACGTCTCGGACA
GCCTGGAGTACATCAAGTCGGAGCATCACTCGGATCTGCA
CAGCTACTACGCCAGCGAGCTGGGCACCATCAAGACCGAG
TACGAGCCCATCTTCATGACCAGCCACATCAAGACCGAAA
TGAACGGCTTGGAGTCCATCCACATGGCGGAGCTCCGCAC
GGAGCTCAACAAACTCCGGCCGGAAACCCTCATCGACGGC
ATCGGGAAGCTGGACTCTGATTTCTCCTCCAACACTCTTT
ACGAACTTACATCAGTCCATGCGAACAAAGCGCAGGCAGC
GCACCACCCAACCAGCACAAAAGGCCACGGGCCGACGCCA
CGCAAACCTCGTAACCCCACAGGGGAGAAACCATTCTCTT
GCACTCAATGTGGGAAGAACTTCAGCACCCTGGGGAACCT
GAAAACTCACAAGCGCATCCACACCGGCGAGAGGCCTTAC
ACTTGCTCCCAGTGCGGGAAGAGCTTCGGTCAGGCCGGCA
ACTTAAAAAGGCACCAGCTCATCCACACGGGGCAAAAACC
TTACACCTGCGCGCACTGCCCGAAGGGTTTCACCAAAGCG
GACGACCTCCGCTCGCACCAGCGGCTGCACACAGGCGAAA
AGCCTTTCAGCTGCGCTGAGTGCGGCAAGAGCTTCAGTCA
AACCAAGGAACTCAAAGCCCACCAGTTGAGCCACACGGGA
GAGCGGCCCTTCTGCTGTTCGCTCTGCGGCAAGAGCTTCA
GCAAAGAGACGAGTTACCGCAATCACCAGCAAATCCACAT
GGGCGAGAAGCCGTACAGCTGCTCCCAGTGTGGCAAATCT
TTCAGCAATTCAGGGGTCCTCAAAACGCACGAGAAGATTC
ACTCCGGGGAGCGACCGTTCGGCTGCACCCAGTGCGGCAA
GCATTTCGGTCGCTTGGGACATCTAAAAGCACACCAGCAG
ATCCACACGGGCGAGCGGCCGTACACCTGCCAGCAGTGCG
GCAAGAATTTCAGCCAATCAGGTCATCTCAAAGCACACGA
GCAGATCCACAAACGGGAACGGCCCGATCTTAGCAGTGGC
AGCAGTCTCAGTAATGATAGTAGCTAAAAGAAACCTCATT
ACGTCTCAAAAAGTATTACTCTTGTTTCTTTTTTTTTTTT
GTTTTGTTTTTTATAAAAGCTACAATATATATAAATATAT
TATAAAATATATATGTTTTCATACTTTTTGTCTCCTTTTT
CTTACTCTTCTTTTGGGTACAGTCGTGACTGATTTTCTGA
TCTGAGAGTGTCTATGTTTGGGATCGGTCAGCTTACAGAG
AGTCTTTGTATCTTGTCTGATCTGTGTCGTAGTGAGTGCC
ATTCTCTAGTTTTCTTTCCTTCAGTAAAATACTCAGTGTA
CACGTTTATTGATAATATGTAATTCTCCAACCATGTACTG
GAATGAATTATTAAAGAAACTAATGTTTAAAAACTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-113d7.1-202 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER si:dkeyp-113d7.1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016882 (1)
  • Ensembl_Trans:ENSDART00000145749 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC163171 (1) 1628bp
    GenBank:BC163182 (1) 1628bp
    GenBank:CK026563 (1) 787bp
    GenBank:BI875849 (1) 558bp
    GenBank:CD605703 (1) 500bp
    GenBank:AI723013 (1) 489bp
    GenBank:AI617093 (1) 450bp
    GenBank:BM072051 (1) 353bp
    GenBank:BM572227 (1) 353bp
    CITATIONS (2)