ZFIN ID: ZDB-TSCRIPT-090929-3531
Transcript Name: fkbp8-201
Previous Name: fkbp8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016778 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016778|OTTDARG00000014078|ZDB-GENE-040426-1849 fkbp8|OTTDARP00000014216 CH211-202N20.2-001 LG_ AL773593.10 Danio rerio protein_coding KNOWN, 2125 bp
CAGAGATTGATCTTGTGTTGTTGTGAAAGTTGTTGCTGCG
CTGCTCTGAGGTGTATTTTCTTCTCACTGCGATGGCGGAC
AGTGATGTTGTGAATGGCTCTGCGGATGACCACGAGGTGG
CGCCGTTGGCTAAGAAATCTGCTGGCGCTTCACTGCTGGA
CAGCAGAGAAGACTTTGAGATGCTGGAACACTTGGAGGAT
GACGTGGATGACGATCTCCCGCCTTTAGAAGATGCAGGTG
GAGGAAAGAAGAAGAGCAGTCCTGCTAAAGACCCTGCAAA
AGAAGACAAATCTGCAGAAAGTCCTTCTGCAGAACCAGAA
GAGTGGCTGGATGTTTTAGGAAATGGGCAGCTGAGAAAGA
AAGTTCTGGAAGCTGGAGCAGGTCCAGACAGCAGACCACA
GAAGGGCCAGAATGTCACAATTCATCTTAAAACTGCTCTT
ACTAATGGAACTGTGGTAGACGAGCTGAAAGATTTATCAT
TTACACTTGGGGATGGGGATGTCCTTCAGGCGCTGGATCT
CACTGTACAGCTGATGGAAATGGGTGAAAAGGCTTTAATT
GAAGCGGCTGCTAAATATGCATATGGTGCCCTTGGCAGCT
CTGCTCCTGCTGTTCCTCCTGATGCTGATCTCCTCCTGGA
GGTGCAGCTGTTGTCTGCTGATGAAGCCCTGGACCTGGAG
CTCATGCCACCGTCTGAGAGGATCATTCTGGCCAACAGGA
AGCGAGAGAGAGGAAACGTCCACTACCAGCGCGCCGACTA
TGCCTTTGCTGTCAACTCGTACGGAATTGCGCTACAGATA
ACTGAAGCAAGTTCGAGAGTGGATATCAGTCAAGAAGAAG
AGGAAGAACTTTTGGACATGAAGGTGAAATGTCTGAACAA
TATGGCGGCTGCTCAGCTTAAGCTTGACCACTATGAAGCC
GCACTGCGCTCCTGCGTCTCTGTTCTGGCGCACCAGCCGG
ACAATGTCAAAGCCCTGTTCCGCAAAGGCAAGGTCCTGGC
TCTGCAGGGAGAGTTTGCTGAAGCCATTAAAACACTGAAA
ATGGCTTTGAAGTTGGAGCCAAGTAATAAGACTATCCACG
CTGAGCTGTCGAAGCTTGTGAAGAAACACTCGGAGCAGAA
AGGAGCCGAACAGGCCATGTATAAAAAGATGCTGGGTAAC
CCGTCCAACAGCAGTGTGCAGAAACACCGTGCCAAGTCCT
CATGGGGTCTCAGCTGGAAGTGGCTCTTTGGGGCTACAGC
CGTTGCAATTGGTGGTGTAGCTTTATCAGTCGTCATCGCA
GCTAGAAATTAACTGAAGTCAGCTGTGATGGATGATGACG
TGGTGCTGAAGATCTTGAGCTCAACAGGCCCCTGAAACAC
CTCACTGACCTTTATTGTACAAAAAAATTAGATTTAAAAG
AGAAATTGTTGTATGTTTTGTTGAGCTCCATCTCACCCTG
TTGGTTTTAAGTAATGTTCCCGCTTTACTTTCAATGCATG
AAAGATCAGCTGGGGAAGAAATAGATGCGAGAGATAATAT
ATAATAATTCCTATTTATGTACAGAGAAGTTTCTAGTTGT
AGTTAAGAGATGTGTGGATGTACAGAATGACGCTGGACCG
TTTTGCTGCAGAATTCTTTGACTGAAAACAGCATTTGTGA
AGTTTCGTGATCTTATTTTTGGTGAACTGAAACTTGCTTG
TGAACAGTCAAGAATATGATTGTATGCTTTTTTTTCTTCA
TCTTTAACTTCTAATGCTAAAGAAAGAGAACACTATTTCA
AAGGTCCTTACACTTCCGTGGTACACTATTCACTATTTCT
TCTGCCTTAGCTTCATAGGCTCCAAAATATCACTGCACCA
AGCGGATGTGTTCAAATCAGCTGTCTCTCAATTATGTTTC
CAGAATTTTTGCAGTTTTTACAGCGCCTACAAGAATTCTG
TGCATTCCGTTAGAATTATTTATTTAGGATGACAGAAATG
TGACCATTTTAAATTATCCTTACATTGATCGTCTCAGTTC
CCCATTCCATTTTCTTTTGTTGTATTGGTAGCTTCCAACA
TTCCCTTTTAAGTTGTTTTGTATTTCCTCAAATAAACTTT
TGCACTTTCTGTTCATATGATTGAAAATAAAGTGATTTCT
TTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fkbp8-201 Contained in:
OTHER fkbp8-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016778 (1)
  • Ensembl_Trans:ENSDART00000002029 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC063964 (1) 2238bp
    GenBank:CF266126 (1) 880bp
    GenBank:CK237006 (1) 793bp
    GenBank:CF348581 (1) 777bp
    GenBank:CK360076 (1) 712bp
    GenBank:AW305853 (1) 711bp
    GenBank:BM957932 (1) 668bp
    GenBank:BM860977 (1) 651bp
    GenBank:BM860638 (1) 641bp
    GenBank:BI984441 (1) 587bp
    GenBank:CD015099 (1) 565bp
    GenBank:CD014789 (1) 564bp
    GenBank:CB361702 (1) 541bp
    CITATIONS (2)