Transcript

acadl-201

ID
ZDB-TSCRIPT-090929-3259
Name
acadl-201
Previous Names
  • acadl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015952 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015952|OTTDARG00000013433|ZDB-GENE-040426-771 acadl|OTTDARP00000013544 CH211-12A1.2-001 LG_ BX927313.11 Danio rerio protein_coding KNOWN, 1753 bp
GGAAGTTATGTTTTCTGTTTTTAGGGTAAAGTTCACGGGC
GATATTCGACCTGTCAAATATTGAGCTTTAGAGTTTGAGT
CTATCACGTCCACATCAGCAGCATGTTCGCATTAAAGACA
TTAAGGAGTTTTTCTCCTGCGGCAAAAAATGTTTATTTGC
GGAGTAAACAGGCTATTGCAGTGGCTGTGTCGAGAATGCA
GCATGCGGAGCTCCAGCATGGAGAAACAGCAGCACCATTT
CGACCTGAAACATCCATGGCCAAAACTCTGATGGACATCG
GTACCAGGCGGATCTTCTCAGAGGAACACGACCTGTTCAG
GCAAAACGTGCGGAGGTTCTTTCAAGAGGAAGTTGTTCCT
TATCACGCTCAGTGGGAGAAGGCCGGTGAGGTCAGCAGAG
AGGTTTGGGAGAAGGCTGGAAAACATGGTTTACTGGGAGT
TTACACACCTGAGGAACATGGAGGAATCGGAGGAGATCTG
CTGTCTGCTGCTATAGTGTGGGAGGAACAAATGTACAGTA
ACTGCAGTGGTCCTGGCTTCTCTCTCCACTCTGAGATTGT
AATGCCTTATATCAGTCACTATGGCTCTAAAGCTCAGATT
GAGCGCTATATTCCACAGATGGCTGCTGGGAAATGCATCG
GGGCCATCGCTATGACAGAACCTGGTGCCGGCAGTGACCT
TCAAGGAGTGAAGACGTTTGCGAAGAAGGATGGAACTGAC
TGGATTCTTAATGGAAGCAAGGTGTTCATCACTAATGGCT
GGATGAGTGATGTTGTGATTGTAGTTGCCGTCACTGACCG
TGAAGCAAAGACAGCCGCTCATGGAATCAGTCTGTTTCTG
GTTGACCGTGGCACTAAGGGCTACCAAAAAGGCCGCAAGC
TGGAGAAACTTGGACTCAAAGCTCAGGACACAGCTGAGCT
GTTTTTTGAGGACGTGCGTTTGCCTGCTGAAGCTTTGTTG
GGTCAGGTCAATAAAGGATTTTACTATCTGATGAACGAGC
TGCCTCAGGAGCGCCTTCTCATAGCAGTCATGGGTCTTGC
CAGCTGTGAATTCATGTTTGAAGAGTCAAGAAACTATGTG
ATGCAGCGGAAGGCGTTTGGAAGGACTATTGCTGACCTTC
AGGTGGTCCAGCATAAACTGGCCGAGCTGAAGACTGAAAT
CTGTGTAGGTCGGGCATTCATTGACAGCTGCCTTCAGCTC
CACAGCGAGAAGAAGCTGGACTCCAGCACAGCGTCCATGG
CCAAATACTGGGCTACAGATTTGCAGAATAGGGTCGCCAC
TCAGTGCCTGCAGCTTCACGGTGGATGGGGCTACATGTGG
GAGTATCCCATAGCCAAGGCGTTTGCAGACGCCAGAGTTC
AGCCCATCTACGGAGGAACCAATGAGATCATGAAAGAGCT
CATCTCCCGTAACATTGTCAGCAAAAAATAAATACAGGAA
AGAAATCAAACGTTGGTGCCTGGACGTTTCAAACGTCTTT
AGCTAGCTGGAGCTTCACGGATTGTTGATTTTAAAAACGA
TCGCAGATGACTCTCTTAATGTATACAAATCATTAAAATC
ATGTGACATTCTGCTAACATCATATGGTCTACGCCGAGAG
AATGTAGCCTCTGTTTCTTAATGTTTTTGCCTTCCATATG
ATCAGTCTGCAGCACTTCTAAACAACAAAAGTCATTTTTA
GTTGTAAAGTTTTTTTGTTGTTTGTTTGATATTGTGAATA
GCGACTCTTTGTCCACTAATAAACCTTTATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations