header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3241
Transcript Name: onecut1-201
Previous Name: onecut1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015908 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015908|OTTDARG00000013397|ZDB-GENE-040426-1469 onecut1|OTTDARP00000013503 onecut1l-001 LG_ BX908748.7 Danio rerio protein_coding KNOWN, 1858 bp
GGCAAGAGATGGCGAGGGACGCGAGCACACCGACACCATG
CACTGCTGAAGGGACGGGGGCCTTAACATTTAGAAAAAAT
ATTAAAACTTTATAAAACATAGAAAAAAGGGAAAAAATAG
AAAAGAAAGCAAAGAAAAATTACTCCATATAAGAACAGAA
CTTTTCCAATGAGAGCACTTCTGTGGACACTGCTCCGCTA
TATCAGATAGATGATTTGTCCACAAGCTTGCACGTATAAT
GAACGCCCAGCTGTCGATGGAGAACATTGGCGATCTGCAC
GGAGTGAGCCATGAACCGGTCCACAGCGCGGCGGATCTCA
TGACCGGAGACAGCGCTCATCACAGGAGTCATCGGAGCAG
TCTGTCAGCCCATGCGCGCTCCATGGGCATGGCTTCAATC
CTGGACAGCGGCGACTATCATCACCACCGGCCCCCGGAGC
ATCCCGGGCTCGCCACGCACCTGCACCCGGCCATGAGCAT
GGCATGCGAGGCTCCCCCCGGGATGAGCATGAGCAGCACC
TATACCACCCTCACTCCGCTGCAGCCTTTACCGCCCATCT
CCACCGTCTCCGACAAATTTCCGCACCACCATCATCATCA
CCACCACCACCATCACCACCCGCACCAAAGGATCCCGGGG
AACGTCAGCGGGAGCTTCACCTTGATGAGGGACGATAGGG
GTCTGGCTCCGATGAACAACCTCTACTCTCCCTACCACAA
GGATGTTGCCAGTATGGGACAGAGCCTTTCGCCCTTGTCT
GGATCCGGACTGAGCGGCATTCACAACTCGCAGCAGGGGC
TGCCGCCGTACGCGCACCCCGGGGCCACCATGCCCGCCGA
GAAGATGCTTACACCCAACGGATTCGAGGCACATCACCCC
GCGATGTTGGCTCGACACGGGGAGCAGCACATGAGCGCGT
CTTCGGCGAGCATGGTGCCGATCAACGTCATCCACCATCA
CCCGCACGCCCATCTCAACGCCCAGGGCCACGGACAGGTG
CTGGGCTCCACTCGGGAGCAGAACCACTCCTCCGTTCCCG
GATCGCAGCTCAACAACGGTAGCAGTTCGGGTCAGATGGA
AGAGGTCAATACCAAAGAAGTGGCCCAAAGGATCACCACT
GAACTCAAAAGATACAGCATTCCACAGGCCATCTTCGCCC
AGAGGGTGCTGTGTCGCTCGCAAGGGACGCTTTCGGACCT
GCTCCGGAACCCTAAGCCCTGGAGCAAGCTCAAGTCTGGT
CGGGAAACCTTCCGTAGGATGTGGAAATGGTTGCAGGAGC
CTGAGTTTCAGAGAATGTCCGCGCTCAGGCTCGCAGGTGA
GAGAACAATAGCGTGCAAACGAAAGGAGCAGGAGCACGGT
AAAGGCGAGCGGGGAAACATCTCCAAGAAGCCCCGGTTGG
TCTTCACCGATGTCCAGCGTCGGACTTTACATGCAATATT
CAAAGAGAACAAGCGTCCGTCCAAAGAGTTACAAATCACC
ATCTCTCAGCAGCTGGGCCTGGAGCTCGCCACCGTCAGCA
ACTTTTTCATGAACGCGCGTCGACGGAGCCTCGATAAGTG
GCTGGACGACGGCAGCTCCAACTCGGCCAACTCCTCCTCC
TCCAGCACTTGTACCAAAGCATGATGGAGTAACGGCTGCA
TTGTGGGGAAAAAAAGAAAAAAAAAACTTCGGTGGAAAAG
CTTTAAACAAAGAAAACTTAACAAAAGACAATTTTAGACA
GCGTTTGCCCTTAAAACTTGTACAGTACCGATATTTATAA
TATCCAAAGAAAAACACCAAAGACTGCTTTGACCTGCATT
TAGGACTTTGTTCGTTTAGCCTATGTCTGACATTCTGCAA
AAAAACAAAAAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
onecut1-201 Contained in:

OTHER onecut1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000015908 (1)
  • Ensembl_Trans:ENSDART00000010177 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056601 (1) 1860bp
    GenBank:BC066466 (1) 1844bp
    GenBank:AL908370 (1) 586bp
    GenBank:AL911090 (1) 558bp
    CITATIONS (2)