ZFIN ID: ZDB-TSCRIPT-090929-3072
Transcript Name: arih1-201
Previous Name: arih1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015337 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015337|OTTDARG00000012946|ZDB-GENE-030131-5213 arih1|OTTDARP00000013021 arih1-001 LG_ BX571681.7 Danio rerio protein_coding KNOWN, 2456 bp
TCTCTTTGTTGGCCCAGCAGCAGCGTCGCTCCTCTGTTGT
TGTTTTCTCTGCTGCTGGAAAAACTGGAATGCTAGCGAGC
TAAAGAAGTATTCTCGTTTGCTTCTGCTCTCCCCGCCAAA
AGACGAACACCAAACTCGCCCCTGCTTGGCGTGTCGTTAT
ACGGTAAGCGCGACCCAGTCATGGACTCGGACGAGGGTTA
CAATTACGAATTCGACGACGAGGAAGAGGAATGCAGCGAA
GACAGCGGCGAAGAGGAGACCGCGGACGACACCCTGGAGC
TCGGCGAGGTGGAGTTGGTTGATCCCGTTGTGGCCGGCGG
AGAGCGAGACGACTGCGGGGAGACCGGGGGTAGCGGCCTC
GGGCCCGGGCAGGACGAGGAAGACTACCGCTTTGAAGTTC
TTACTGCCGAGCAGATCCTGCAGCATATGGTGGAGTGTAT
CCGGGAGGTCAACGAGGTCATCCAGAATCCTGCTACCATC
ACTAGAATATTACTTAGTCATTTCAACTGGGACAAGGAAA
AGCTGATGGAAAGGTACTTTGATGGTAACCTAGACAAGCT
GTTTTCAGAGTGTCACGTTATAAACCCCAGCAAGAAATCT
CGGACACGCCTCATGAACACAAGATCGTCGGCACAGGACA
TGCCATGTCAGATCTGCTATCTCAACTATCCTAACTCGTA
CTTCACTGGTCTGGAATGTGGGCACAAGTTCTGCATGCAG
TGCTGGGGCGATTACTTAACCACCAAAATCATAGAGGAAG
GAATGGGACAGACCATTTCTTGTCCTGCTCATAGCTGTGA
TATTCTGGTGGACGACAACACCGTAATGAGACTGATTACA
GATTCAAAAGTGAAGTTGAAGTACCAGCATTTAATAACCA
ATAGTTTTGTAGAGTGTAACCGACTGTTAAAATGGTGTCC
TGCGCCCGACTGTCATCATGTTGTCAAAGTACAGTACCCA
GATGCCAAACCTGTAAGATGCAAGTGTGGACGACAGTTTT
GCTTCAACTGTGGGGAGAATTGGCATGATCCAGTGAAGTG
TAAGTGGTTAAGAAAATGGATTAAAAAATGTGACGATGAC
AGTGAGACATCGAACTGGATTGCAGCCAATACAAAGGAAT
GTCCGAAATGCCACGTCACCATAGAGAAAGATGGTGGCTG
TAACCATATGGTGTGCCGAAACCAGAACTGCAAAGCAGAG
TTTTGCTGGGTCTGTCTGGGCCCCTGGGAGCCACATGGTT
CTGCGTGGTACAACTGTAATCGCTATAATGAGGATGATGC
CAAGGCAGCACGGGATGCGCAGGAGCGTTCCAGAGCAGCC
CTGCAGAGGTACCTGTTCTACTGCAACCGCTACATGAACC
ACATGCAGAGCCTGCGCTTCGAGCACAAGCTGTACGCTCA
GGTCAAGCAGAAGATGGAGGAGATGCAGCAGCACAACATG
TCGTGGATTGAGGTGCAGTTCCTGAAGAAGGCCGTGGATG
TGTTGTGCCAGTGCCGCTCCACGCTCATGTTCACCTACGT
TTTTGCATTCTACCTCAAGAAGAACAACCAGTCTATCATT
TTCGAGAATAACCAGGCAGATCTGGAAAATGCCACAGAGG
TTCTATCTGGATACCTGGAGCGAGACATTTCCCAAGATTC
CCTGCAGGACATCAAGCAGAAAGTACAAGATAAATACAGA
TACTGTGAGAGCAGACGGAGAGTCCTGCTGCAGCATGTAC
ACGAAGGCTATGACAAAGACCTGTGGGAGTACATCGAGGA
TTGAGATTGATCTCCGCACCACAGACTCTCGGAGAGAAGC
TCCAGCCACTAGAGCACTGATGCAATGACCAGAGCAGCCC
TGACCAGCTGCCTCCTGCCTGGCCAAGCCGCCCTGCGTTG
CATCACTTCCCCAGAACAGCAGAAATTATATTTAAATTAG
AATATTACAGAATAAAATATTACATGCTCAACAGTATTGT
CAGCAGCGCAAGACTGAGAAATCCAACAAAAAGGCAAAAA
TCTCTTCCTTTTGCTTGCATCGTAAGATCTTCCCCCTCCT
CGGAAACAAATGTTTTCCTCCTCCTCAGTTACGTTTGTGG
ACGTGTTCTGTTTGAATTTATTTTAAATACACTATTTTTT
TTTTGGTTTGTTTTGTGTGCGCGCGCGTGTGTGTGTGTGT
GGAAAATGGACTTTGGTTTTTTTTCTCAAAAATGGCTTTA
ATAATTTTGACCATGTCTGGCAAGCTCTGTGTTGTTTGGG
TTGCTGAATGTTGATTGGTTGATTGTTAAGAAGGCTTCTT
TTTGGCTTCGTGAAGAAAAAAAAAGAAAACACCAAAAAAA
AAAAAGACGACAAAATCGGTATTTTTCAATTTGTAAATAA
TGCATATGCATGGAAGTTTAAAGAGTAAGAGTGGCATGTG
TTTGCATCATTTTTAAAAGATATTTATCTTTACAAATATA
AAAAAACTGTATATTT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arih1-201 Contained in:
OTHER arih1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000015337 (1)
  • Ensembl_Trans:ENSDART00000019581 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC057523 (1) 2383bp
    GenBank:BU710178 (1) 620bp
    CITATIONS (2)