header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2931
Transcript Name: ccnd2b-201
Previous Names: ccnd2b-001, si:ch211-240j22.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014848 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014848|OTTDARG00000012582|ZDB-GENE-050420-354 ccnd2b|OTTDARP00000012648 ccnd2b-001 LG_ CR751235.5 Danio rerio protein_coding KNOWN, 2538 bp
GGCACAGCCACATGCAGCTGGCACTGTGAAGTGGTTATTA
CACAGCCTATAACTCCGAGAAACATGGAACTTTTCTGTCT
GGAAAAGGACACAGTCGTGCGAGCTCAGAAAGATCCCAAC
ATCTTCTGCGATGAACGAGTATTGCAAAGTCTTCTAACAG
TGGAAGACAGATACGTTCCGCAGGGACCTTATTTTAAATG
TGTCCAGAAGGATATTCAACCTTTTATGAGGAAAATGGTT
GCGACGTGGATGCTGGAGGTGTGTGAAGAGGAGAAATGTG
AAGATGACGTTTTTCCGTTGGCTATGAACTACCTGGACAG
ATTTTTAGCTGCAGTTCCTACGAGAAAATGTTATTTGCAG
CTCTTAGGAGCTGTTTGTCTCTTCCTAGCTTCAAAATTAA
AAGCATGCCAGCCGCTGTCGGCCAGGAAGCTCTGCATGTA
CACAGACAACTCCATTACATCTCAACAACTGCTGTGGGAG
TTGGTGGTGCTCAGTAAATTGAAATGGAACCTGGCTGCCA
TCACTCCTCTGGACTTTATCGAACACATCCTGCACAAACT
GCCCTTTCACGAAGACAGACTGACGCTGATCCGCAAGCAC
ACGCAAACCTTCATCGCCCTCTGCGCGACAGATCATAGCT
TTACCATGTACCCTCCCTCCATGATCGCCACAGGATGTGT
GGGGGCAGCAGTGTGTGGCCTGCAGTCCAGCCAGAGCAAC
CAAAGCCTGTGGGGCGACAATCTGATGGAGCTGCTGGCTA
AAATCACCAACACTGAGCTGGACTGCCTGAAGTCATGTCA
AGAGCAGATCGAACAGTTACTGACCGACAGCTTGAAAGAA
AGCCAACAGCAGCATCAGCAACAGCAGCAGGATGGCAGAG
CCAGCAACAAAGGGACGCAATCTCAAAACCTATCCTGCAC
CCCCACAGACGTCCGGGACGTGAACTTATGATGTCACTTC
CTGTTCCTATCCAACAGATGCATCAGTTATTAATATATTA
CTGTATTTAAGTAATTCCACACGACTGTCACGATCAAATA
AAACACACACGCAGGATATTTTTGTAAAGGAGCAAACCAG
CTGCTGCTGCCGTCTGGTAACTGCAGGCGGTGGCGTTTAA
CATACTTGAACTTCAACCTCGAATTATAATTCATTCAGTA
ATGCGGTGATAATTTATAGTAATTAAAGGAGATAACAGCT
ATGTTGGCTATCATATGCAGCCATATCAATGATTGATATT
GTTTAATAATTAGAAGAACAGCATACTATTGTTGTAGTTA
AGAATATTAGGCTTTTTATCTAGTGCTGGGCAAAAAAATT
AGCCGCATACAAAATAAAAGTCTGTTTTGACATAATATAT
GTGTGTGTACTGTGCGTATATAAATACACACGTGCATGCA
TATATTAGAGAAAATGTTTATTTATATTTAGTTGCCAAAT
ATATATGCATATGTTACAAATTATTAATTTAAATACCTTT
TGTGTAACAATGTATGTGCGTATTACATATACGTATATAT
TTAATGCACGCACACATACACTTATATATAAATATATATA
TATATATATGTCAAAACAATTATTTTGCATGCGATTAATC
ACGATTAATCTCTATTTTAGTTATATAAGATGCATTAGTA
CTTCTATTTTTAAATATAATACTAGGATAACTCAATAGTC
AGATCAAATAGTTTATCATAGAGATATTACAGTAACACAG
TGATCTAATGTGTGATATCAGATAGCATAGAAACGATTTT
ACAGACGAATGTTATCGCATGCATACGCATATATGAATAT
ATTAGGCCGTTTCTATCCATGCATGGTGACCAGCCTAATG
AGCACACCAGTTTCAGATGGACACTAAGTATGTAGTGTAG
GTGGAGTAAAGGTGAAGTAGACGAGGGAGGAAAGCGTTGA
ATTAAAGAATGCAGAAAGATTTTGCACGTGATTTAGATTT
AGTAGATGGTTCCTGGATAGGTTTAGTCTTTTCAGATAGT
TGTGACGATTAAGTGGTGCTGTTTGCTCATGTTTGAACGC
CATCATATTTGGGTTAGAGACAGTCTTATGTATGTATGCT
GGAGGGATTTAATCATTTGGGAGACTTAAATTCCTTCTTA
GCAAATGCACTTTCAGATATCACCTCTCGCTGGCTATTTG
TGGTAGATTGATGACTATTTCTAAGGGTCTTTTCTTTTTA
AGTTATTTTTTGTTTTGGGGGCTGGTTTCCCATGTTAGGA
GTGCTTGCGGGTTATAGTCGGTTAATATTACAGCAATACA
TATAAACCAAAAACGACTGATCTAACTGTCAGCTGCCGTA
GATGTGGGTTGACATGCTTAGTTTAGTTTTTATTTCTTCT
TCTTTTTTTTAGTTGTGTTGAATTCATGTCAGCATTATGG
AAGCTTGTTGCCAGTTTAGATTTTTTTATGATGAAAAAAT
ATCCCTTTTTTTTTGTTAATATATTAATTGCAAGTCAAAA
TCTGTAACTTTACATTAACTACACACTATGAGTCATTTAA
TAAGCATTAGCAAATAGT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnd2b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000014848 (1),  Ensembl_Trans:ENSDART00000103279 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:FJ648074 (1) 951 bp
GenBank:EB915613 (1) 647 bp
GenBank:EB920889 (1) 166 bp
CITATIONS (2)