header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2802
Transcript Name: aox5-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014387 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014387|OTTDARG00000010181|ZDB-GENE-001205-2 aox5|no_translation CH211-246M6.12-002 LG_ BX649296.3 Danio rerio protein_coding NOVEL, 542 bp
CAGCATTGGTGAACGTCTACAAAGATGGATCAGTTGTGAT
TTCTCATGGAGGAACTGAGATGGGTCAAGGTATCAACACC
AAAGCCATACAGATTGCAAGCCGCATTCTGAAGGTTTCAA
TGTCCTCGATCCACATCAAAGAGACTTGTACTGGAAATGT
GCCCAATGCTGCACCATCCGCGGCATCTTTCGGCACAGAT
GCTGTTGGGATGGCGGTCAAGGTATAAAAACTGCCAATTT
TCTGGTATTTATGCATCATTTCGTGACTAAAATTTAAATA
TTTTTACACAGAATGGTTGTGAGAAACTAATGAGACGTCT
AGAGCCACTCATTAAGAAACATCCCCAATACACATGGCAA
CAACTGGTGGTGGAAGCTTACTGCCAGAAGATTAGTTTGT
CAGCAACTGGTTTCTTTATGTAAGTGGTCAATCTTGAAGC
AACATGTAGCCACATGATAAAATGTTTGAACATCTAACAA
AATAGTTCCACTGATTGTGAGTTGAATGAATATGTCTTAA
TAAATAAATCAAAGCAATGATT

aox5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA aox5-201 (1)    Ensembl 4033
ncRNA aox5-002 542
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aox5-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000014387 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AI657925 (1) 543 bp
GenBank:AI657926 (1) 121 bp
CITATIONS (1)