header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2694
Transcript Name: aspm-201
Previous Name: aspm-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014012 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014012|OTTDARG00000011999|ZDB-GENE-050208-620 aspm|OTTDARP00000011975 aspm-001 LG_ CR388178.5 Danio rerio protein_coding KNOWN, 10507 bp
ATTTGTAGTTCAGCTCAGCAGCACTGACACATGGATTTAC
CAACTTCGTTGTTCGCTTAGATGAGCCATAAACATAAACA
TGTCGTTTAAAGTAGCGAAATCGGAGTGTTTGGACTTCAG
TCCACCGCTTGATTCTCACTGTAGTCGCGATAAATCCGGT
AAGGAAAACAGCAGTTCGATTCCTGTGCTGAGTTTACTTC
AGTTTTCCAGAGCTCCTTTCGTGTCGTTCGGGACGATCAA
GTTGGGATCTTCGAAATCTTTACCTTTACGAATTGAAAAT
CCCACTGATGATGCCACAGCTACAGTCATTGTGGATAAAA
TCTCAGCATCCAAGGGCTTTTCGGTGGATCAAATGTCGTT
CACAATACAGCCTGAGGACAGTATCATTTTAACTGTTACA
TGGACACCAGTGGAAGAAGGTGGGATTCGAGAACTCCTCT
GCTTTATTGCAAATGGCATTGTCAAACATCAAGCAATATT
GCTTGGGAAAGCAGAGACGACAAAAAAGAAGAAGAAAACC
TTGTGGGATTCAATTAAATCCAAGAAGGGGGTACCTGCAC
CTTCAAAAGAGAAGAAAGTGTCAACAATGCCTATCAAATC
TGTAAATAAGACGTTTCACGTGTCTCGTCAGTCACAATAC
AGAAAAGACAGAACTTCAAACCCATTGTCCCCATTAAACC
AAAATGGGTCCAGAAGGGTAAACACACCATCATCTACTCC
TGAGATGCCAAAGCCTGCTTTTATAACTGAAACTTTTGAT
AATGTACATTTGCAAAAAGACTCGCCAGTGGTTGTCTTGG
TGCCAGCAGAAAGATTGCTTGATACACCAGGTAAAAAGGA
TGCACCTTCTTCACGTCAAATAGAGTGCAGAGAAATCACA
AGAGTTTTGAATAAAACTCTCTCTCCTGCCAGCACCCCAG
AGAGGTTTAGAAATCCATTGTCGTCAGGCTTTCAGAGTCC
ACTTCCTGTGATTGGACAATTTGTGCAGGATAAAAGTCGA
GAGCCAGAGAAATTGTCTCTGTCTGTAAAAGATGCTCTGG
ATGTTATAGGATCAGATCTGTCGCATACAGTAAGCCCACC
GAATGCTTGCTCAAGCTTCGATTTTTCTGATTCTCTGGAA
TCTGACAAACCGGACCCAGGAGCGTCCTTTAGAGCAAGAA
GAGTCATTTCACCACCAGTTGAAACTGCTGACCCGAGGTT
GACTTTCTGTGTGAAACCCAACAAAGCCATAGGCATTGCA
TCAAATCAAGATGAATTTAGGCTCAAGGCTTTACCTTTTA
GCACCGCCACAGTGACAAAGTCAATTAAAGTAGATGACAC
CCATGTCCCAGATGACCCCAAGACGTTTCCTGTTAATTCT
GCCACAGTGGTCAAAAGCAAAGCAGATGCTTCTGTTGAGA
GTCCAGGACTGCGTAAGAAGAAAACCTCAAGGCGCAGACT
CTTGGAGAAGACATTGGAGCTTTCAGAGCCTAGTAATGCA
GAATCCAACACAAGTTCTCCTGACAGCTTCTCTGCTCTAC
CAGTCATCAACTCCGATTCAAGTCCAGATCTGCCACTGGA
ATCGAAAATTTGTCCAGTTGCAAAAAAGAAGCCAACTTTA
AATTTATCCCCTCATGACCAACTTTTGTCCTCTATTTCTC
CCATACGACCTCAAGTTTTCCCCTCTGTTAGTAATAGTCC
GTCAAGCAGCTTAGAGCTGTCAGCCAGTCATTTCTCTGAA
AAAGTAAAACCAAATCTTTTGGAGAATCAGTTTCCCGTGC
AAAGCAGGACATTAGTGCAAAGTAAAAAAAGAAAAAGCGA
TGAGTTTTTGAGAGGTCACTCAGAAGACAAGTCAAACATC
CAAGCAAAAAAATGCCGAGCTCCTGCGCAGGCAACTGAGA
AACCAAGTCAAGAAAGAACACTTACTTCAAGGTCTACATC
TGGACCACAACGAAAAGCTGTTGGTGAGTCAAATGCTCGG
TCTGTGAAGTCAGCCAATAGCTCAACTCGAAAGACTGCGA
GGATAGTAGCTGTGGCACAGGCCAGACTGACCTTTATGAA
GCCGACACAGACGGCCATTCCAAGGCATCCATTGCCATTT
GCGGCAAAAAACATGTTTTATGATGAGCGATGGATCGAAA
AGCAAGAGCGAGGCTTTACTTGGTGGATGAACTACATTCT
CACTCCTGATGACTTCAAAGTTGCTACTGAAGTTACCAAA
GTGAATGCCTTGTCATTAACTATGGGGAACGACAAATTCA
ACATACCAAAAGCACCAACAAAAGAAGAGATGTCTTTTAG
AACCTACACAGCACGTCAACGGCTCAACCGCCTTAGGCGA
GCAGCTTGCAAGCTTTTTACATCAGAAGCCATGGTGAAAG
CTATCCAGAGGCTAGAACTGGAAGTAGAAGCCAAGAGACT
CCTTGTGCGAAAAGACAGACATCTCTGGAAAGACATAGGT
GAGCGCCAGAAAGTTCTCAACTGGCTCATATCGTACAATC
CACTTTGGCTGCGAATTGGACTTGAGACAATTTATGGAGA
GCTAATATCACTGGAAAGCAACAATGATGTCATGGGACTG
GCCATGTTTATTCTTGGGCGTCTGCTGTGGAACCCAGATT
TAGCCGCTGAGTTCAGACACTCTAAAGTGCCGCATTTGTA
TAGAGATGGCCATGAGGAGGCACTGTCTCGCTTTACACTG
AAGAAACTAATCCTGTTGGTCTGCTTTCTGGACAAAGCTA
AAGAATCCAGACTGATTGAACATGATCCTTGTTTGTTTTG
CATGGATGCTGAATTTAAGTCAAGCAAAGATCTGCTGCTG
GCTTTCTCACGAGACTTCCTCAGTGGTGAAGGTATTCTGT
CTCGGCACCTCAGTCACTTGGGTCTCGCAGTATCCCATGT
CCAAACTCCCCTTGATGAGTTCAACTTTGCCGTGAAAAAA
CTCGCCGTTGACTTGAAATGTGGCATCCGTTTAGTACGGG
TCATGGAGCTCTTTACTCTGGACTGGACTTTGTCTCGGAA
ACTGCGCATACCTGCTATAAGCCGCCTGCAGAAAGTTCAT
AATGTTGATTTGGCACTGCAGGTTCTGAAAAACAAAGGTG
TTGACCTTCGAGATGAACATGGAGCAAACATTGACTCCAG
AGACATTGTGGATGGACATAGGGAAAAGACCCTAAACCTC
CTGTGGAAAATCATATTTGCCTTTCAGGTGGAAGTGCTGC
TTGATGAGAATCAGCTCAAAGAAGAAATCAGTTTCCTCAG
GAAAACCTGGAGAACAAAACAGAAACTGGCCTCAATAATG
GCTAACAACAGTGTTACGGTGTCGAGAATGAAGGCGAGAC
GAGCATTTGAGCATCCCAGTCAGAAAGTGACGCTTCTTAT
GGACTGGGTCAATGCTGTTTGTGAGTTCTACAGCTTGAAG
GCTGAAAACTTCACCGTGTCATTCTCAGATGGTCGTATCC
TCTGCTACCTCATCCATCATTATCATCCTGGTCATCTCCA
TGCAGAGGAGATTCAACAGAGAACCACACAGACCATTGAA
TGTGGTCATCGTGGCAGAGTTGAACTCAATAACTCCTCCA
GTGACTCGGATTGCTCTTTTGAAAATTTGGCCACAATGCA
GTCTGAATCTGTTACAGTGGACTTCAGGGAGCTACTTGAG
AATGAGAAAAGTAACTTTCAGTTGGTGAACACTGCTGTGT
CTTATCTTGGAGGCGTGCCTGCTATGATAAATCCAGAGGA
CATGTCCAATACTATTCCAAACGAAAAGGTTGTCACTTGT
TACCTCTCCTTCCTTTGCGCACGTCTTTTGGATCTCCGTA
ATGAAACAAGAGCAGCTCGAGTCATTCAGGGTGCATGGCG
GAGATACAAGCTTCAGAAGGACATTGCGCTTATGCATGAA
AAGAACCTGGCTGCCACTAAAATACAAGCACTTGCACGGA
AGTTCATCCTGAAAAGAAGATTGATCCGACAGAATAAGGC
TGCTGTTAAGATCCAAACATTATGGAGAGGGTACAGTGCA
CGGGAAAAGCTGAGAGTGCTGAAAAAAGAGAGACATTATG
CACTTCAAAATGCTGCTGCAACCTTAATCCAGAAAACGTA
CAAAGCTTGGAGGGTTAAGAATCTCCTAAAGAAGAACCGT
TCCGCCTTTGTGATTCAGGCAGCTTTCCGGAAATGGCATG
CAAAGAAAATGCTGGAAAGAAACACTGCAGCTTTGCGCAT
TCAAGCATGGTACAGAATGCAGCTGTGTAAAAGACAATAC
TTGGAAATGAAACGGAAAGCAGTCTGCGTTCAAGCATGGT
TTAGAGGGCACCTTCAAAGATCCAAGTTTCAGAATTTAAA
GAAAAGACATCATGCTTCAGTTGTCATTCAGAGTGCATTC
AGGGCCTACCTCATCAGGAAAGAGTTATCTAAAATGAAGC
AAAATGCAGTCTTGATTCAGAGGTGGTTTCGAGCCTGCGT
GCAAAGGAAAGCAGAACAGAAGAGGTATTTTGAGATTAAA
TCGGCTGTTCTCGTTCTGCAAGCAGCTTTCCGTGGTTGGA
AGGTCCGTAAATCTGTTGCTCAACACCACCGATCTGCACT
AGTAATTCAAACTGCCTTTAGGAGGTTTACTGCACAAAGG
CATTTTTTGTGCTTGAAAAGATCAGCCATAGTTCTGCAAC
AGAGATACAGAGCTAAAGTGCATGGAGGCAAGTTCCGGAA
AGAATACATGGCTCTTAAATCCGCTTCAGTGAGAATTCAA
GCAATGTGGCGAGGACGAGCCGAGAGGAAGAAGATCAGTC
AACTCCACAGATTTGCCAAAATCATTCAGTCAAACTATCG
GAGGCATCTGGAACAGACAAGGTTTTTGCAAATGAAACGG
GCTGCTGTAGTTATTCAAAGACAATACAGAGCTTTCAGAG
ATGGACAGAAAGTGCATGCAGAATACACCAAAATCAAAAG
AGCGGCCATTATACTACAGAGTGCGTATCGTGGGAGGAGA
ATAAGACAAGAACTGCAGAGGAAAAACAAAGCTGCGACTT
TGATTCAGTCTGTGATGAGAGCACATATGTGCCATCAGCA
GTTTTTAGCTCAAAAACATGCTGCTATTGTCATTCAGCAG
CAGTTTCGGGCTTTTACATTTGGACGAATGGAAAGAAGCC
ACTATATGCGATTGAGAAAGGCAACTATAACCATGCAGGC
CATATATCGGGGTTCCAAAGTGAGGCAGAATTTAAAAAGA
GAACATCAAGCTGCTACTGTCATTCAAGCCCAATTCCGAA
TGCATAAGGTCCGCATTCCTTTTGTTGCCGCAAAGTGTGC
AGCTATCCTTATACAGCAGCATTATAGAGCCTATAAGGTT
GGCAAAACTGTGCAAGCTACTTATTTACAAATGAAAAATG
CGGCCGTAGTTATTCAGTCAGCTTTCAGGGGGATGAAAGT
TCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTG
ATTCAGGCACATTTCCGTGGACATTCCCAACTCAAAAAGT
ACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAACG
ATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAA
TATGCAGCCATAAAAACTGCAACAATATGTATTCAGTCTG
CTTTCCGCGGAATGGTGGCGAGAAAGCAGATCGCAGAAAA
GCAAAAATGTGCTAAAATTATCCAAAAGATGTATAGAGCA
TACAAACAACGTCATGATTACCTTGCTCTTAGGAATGCCA
CAATTCGTATTCAGCAACAATACAGAGCAGTTGTAAGTGC
AAGGCAACAGCATCAAAGGTATTGCTCCTTGCGAGCAGCT
GCCATCACTTTGCAGTCTTCTTACAGAGGGTTGAGGGCAA
GAAAAGAAATCAATAGAAGACAAAAAGCAGCCACTGTGAT
TCAGGCTGCTTACAAAATGTACAGAACAAGAGTACCTTTC
CAAGCCATGAAACTGGCTTCATTGGTAATACAGAGGCAGT
ACAGGTGCCATTTACTGAGAAAAAAGGCAAGAGAGAACTT
CTTAAAACTAAAGCAGAGTGCAGTAGCAATTCAAGCTATA
TACAGAGGAAAACTTGCACGCCGTGATCTTGCTAGAAGGC
ATTTTGCAGCCACAATCATTCAAAGAAAGTACCTTGCCTA
CAAACAAAGGAAGTGTTTTTTGACCCTTCAAGCTGCTGTT
ATATTCTGTCAACAACACTATCGATCCATTTTGCTTACAA
GGCATGACCGAAAAGATTATTTGACTAAACGCAGAGCTGT
GGTAGCAATCCAGGCAAGTTTCAGAGGGATGAATGTCCGG
CGCCAGATCCGAAGAGAGCACAAAGCTGCAACAATCATTC
AGTCCCATGTGAGAATGCGCATCCTCAACTTGCGCTTCCA
GCGACTTCGATGGGCAGTCTGTACTGTTCAGCAACGTTTC
AGAGCTAACAAAATCATGAGGCAAGAGATGGCAGCACTAC
AGGAAAAGAAAAGTGCAGCTTTGATTCTGCAAGCAGCCTA
TCGTGGCAAGAAGACCAGACAGGCTTTGAAGCAAATGCAC
CAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGA
TCCTTAACTTGCGCTTCCAGCGACTTCGATGGGCAGTCTG
TACTGTTCAGGAGCGTTTCAGAGCTAACAGAATCATGAGG
CAGGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTT
TGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGACA
GGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAG
TCCCATGTGAGAATGCGGATCCTTAACTTGCGCTTCCAGC
GACTTCGATGGGCAGTCTGTACTCTTCAGCGACATTTCAG
AGCTAACAAAATCATGAGGCAAGAGATGGCAGCACTACAG
GAAAAGAAAAGTGCAGCTTTAATTCTGCAAGCAGCCTATC
GTGGCATGAAGACCAGGCACACGTTGAAGCAAATGCACCA
AGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATC
CTTAATTTGCGCTTCCAGCGACTTCGTTGGGCAGTCTGTA
CTGTTCAGCAACGTTTTAGAGCTAACAGAATCATGAGGCA
GGAGATGGCAGCACTACAGGAAAAGAAAAGTGCAGCTTTG
ATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGACAAA
CTTTAAAACAAATGCACCAGGCTGCCACCATTGTACAGGC
AACTTACCGAGCTTATAGTGGACGTAAGCGGTATTTAGAA
ATGAAATGTGCTGCCATTGATATTCAGCAAAGATATCGGG
CTGTAAATGCAGCAAAGCAGCAGAGAAAGAGTTATCTTAA
AGTGCGTCAAGGTGCACTTGTTCTACAAGCGTGCTATAGA
GGTCGTAAAGTTAGGAGGAACCTGCAACTACAGTGCCAAG
CCGCTGTCTTGATTCAATCATATTTTAGAAGACACAAAGA
GATGGTTAAGTACCAGGCCATGAAGCTGTCTGCTGTCATT
ATCCAGAGCCATTTCAGGTCATACATCCAGGCTAGAGCAG
ATCGGAAGAACTATCAACATTTGAGAAAATCTGCCATAGT
CATTCAAGCTGCTTTTAGAGGACACTCTCTCAGGAGACAT
TTAGCAAGAAAGCAAGAAGCTTCTGTTATCATACAGGCCA
GCTTCCGCATGTATCAGCAAAGGTCAGCATTTAAGAAACA
GCGCTGGGCAGCCAGGGTTCTCCAGCAGAGGTTTAGAGCT
TTAAAACTTCGAGATGAGCATGTGTGTCAATACCAACAGG
TGAGGAATGCTGCTGTATGTCTGCAGAGGTATTTCAGAGG
GATGAAGGGGAGAGAATTGGCTAGACGAAGCAAGGCCGCA
AGAACTATCCAGTCCTTCCTAAGAATGTCTGTCCAACGAC
AGCGTTTCATGAAAGAAAAGGCTGCAGCCATTGCAATTCA
ATCTGCCTACAGAGGTCATTTTGCTAGAGCTCAGTATACT
AGAATGCAAGCAGGTACAGTGCTCATCCAGAAGTGGTACA
GATCACGCAAACTGGTCCAGGAGGATCGGAAAAGATTTGT
TGCTGTTAGACAAGCTACGCTTACCTTGCAGTCTGCCTTG
AGGGGAATGCTGGTGAGGAGGCTTGCAAAAAGAAGAAGGG
CTGCAATAAAGATTCAGTCTGTGATGCGCATGCACATACA
ACGCAAGCGCTATGTAACTCTCCGTGCAAGTGCCCTGAAG
TTTCAAGCTCATTACAGAATGTTAGTGGCCCAAAGAAAAT
ACCGTCGATTGCAGGCTGCAACTGTTACTCTTCAAAAGCA
TTACAGATCTCATAGGGCTACATTGGAGCAGAGGTGCAGT
TATCTGAAGACTCTCCAAAACATAAAAAAACTTCAGGCCA
GAGTACGTGGACACATTGCGTACAAACGATTTCAGAGATT
GAGAACATGTGCCATCACCATTCAGGCAAATTATCGAGGG
ATGATTGAGAGACGCAGGTTTCACCAACTCAAGGAGTGTG
CATTGGTTATACAGAAGCATTACAGAGCTTTCATTCTTTG
CCAGAAAGAGCGTTCAAAGTTTCTTCAGCTGCGACAATCT
GCTGTTGTGATACAAAGAGCATATCGAGCTTATCAAAAAA
GACAAAATGCAATGAAAGCACAGGCTGCACTGAAAATTCA
GGCTTGGTTCAGAGGACGCCTTGCTAGACGCAACTACATC
TTAAAACAAGCCGCTAGTGCCACCATTCGAAGATGTATCC
AAGCGAGACGCCAACGCTCTAAATTTCTAGCAGTCCAGCA
CAGTGTCCGAGTGATTCAGCAAAGATGGAGGGAAACTCTC
AGCTCAAGAAAACAGCATGCTGAGTTCCTAAAGTTGATAA
AGTCTGTTATATACATCCAGGCGTTGTGGAGAGGTCGGAG
ACTAAGGGATTCCATTCAAAAGCAAGCAACAGCTGCTGTG
AAGATACAGTCAGCTTTCAGAGGCTCTATTCAAAGGCGGC
GCTATCATCAGCAGAGAAATGCTGCCATAACCTTACAGAG
GCATTTCAGAGTCCTGCGACTTGCCAGAGTGAAGGAAGAA
AATCTAAGACGACGACACAATGCTGCCATTTATATTCAAG
CTTTGTGGCGTGGTTGGCTTGCAAGACAGCAGGTAAAAGA
AATGGCTTTTGCCGCAAGACGCCTTCGTTTCACAGCTGCT
GTTTACCATCATCTGTCCGCAATAAAGATCCAGAGAGCTG
TGCGTGCACACTGGGCCCTTAAATCAGCCAAGAAGAAGAT
CTCATCTGTCCTATACATCCAGCAATGTTTTAGGGCAAAA
CTGCAGAGAAAGAAATATCTAAAAGACAGAGAAGACATCA
TCAAGACCCAGAGAGCAGTGAGATCTTGGTTACATCGCCG
CAACCAGGCTGCCTCTATTATCCAGCACGCAGTCAGGAAG
CTGCTTTTTAGACGTCGCAAGGAGAGGCTACAACGTGGTA
TAATAAGGGCACAGGCACTCTGGAGGGGTCATTGTTCAAG
AAAACTTCATGATACGAACAAAGTCATTTCCATGCGGCAG
CGTCTCAGAGAAGTAAATCAAAGGGTGAAGGAAGAGGACA
AGCTGTGTAACAAGACCACAACAGCGCTGACTTACCTGCT
AGGACTCCAGAATTATGCTTTCATACTTGCAGCATTGAAA
CACTTGGAAACTGCCACCAGGCTTTCTCCAGAGTGTTGTG
AACGTCTTGTGGAAAGTGGAGCAACACACACCATTTTTAC
TTTGATAAGGAGCTGCAACCGAAGTGTGCCTTCAATGGAG
ATCATCACATTATCCATCCAAGTCCTCCTCAACTTATCAA
AATACCACAGAACCATTGATGCCGTTTATGATGTGGACAA
CTCTGTAGAAACCCTACTGGATCTTCTGCAGATTTACCGA
GAGAAAGCTGGAGATAAGGTTGCAGATAAAGGCGGCAGCA
TCTTCACCAAGACTTGCTTTCTTTTGGTTCTTTTAGTCCA
GGATGAGAGAAGAGCAATGGAGATTCGAAGGCTTCCAAAG
GTTATGGATCGAATTCGCAGCATCTACCGACTCACTCTTC
GAAAATGTAAGATGGATGCTGAGAGAAACAAAGTCAAGCA
GAAAATGAACACTTCTCTCAATGGAAGTTTTCTTCTCCAG
GCCACCCCTCGTAAATCAAAACCAGTGGCCAGGTTTGCTC
CAGACTGGGTTTTACGGCGTGACAAAATGAAGGACATTGT
GGATCCTCTCCGTGCTATTCAGATACTGGCTAATGCTCTT
GCTATTGTGCCTTGAAAATATTGAAGCTAAAAAAACGGCA
ATGTGTTTTATTGTTTTTCAAAAGTGTGTTAGGCTTGTAA
ATATTGTGCATTCTTTGCATTGTGTATATGTTTTTATTAC
ATTATCACTCAAATGTTGTGGACGAATGCTATCTGTGCAT
ATTATGGTCTGTACTGAGATGCTCATGTTAGCTCTTATAT
GCTGTAAATACAAGTGCTTTTTACGCATTTTAATTGAACA
TTAAAAAAACCACAGCTTTTCCCATTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aspm-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000014012 (1),  Ensembl_Trans:ENSDART00000157940 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC116488 (1) 1805 bp
GenBank:BC096799 (1) 1801 bp
GenBank:CN840942 (1) 880 bp
GenBank:CT651666 (1) 861 bp
GenBank:BM141409 (1) 772 bp
GenBank:AL719620 (1) 722 bp
GenBank:AL721597 (1) 711 bp
GenBank:AL722750 (1) 695 bp
GenBank:AL718965 (1) 688 bp
GenBank:AL716265 (1) 686 bp
GenBank:AL726666 (1) 671 bp
GenBank:AL731246 (1) 648 bp
GenBank:AL723808 (1) 635 bp
GenBank:CK713925 (1) 617 bp
GenBank:AL731306 (1) 615 bp
GenBank:AL718911 (1) 610 bp
GenBank:BF156705 (1) 595 bp
GenBank:BG303443 (1) 580 bp
GenBank:AL720781 (1) 526 bp
GenBank:AL720782 (1) 526 bp
GenBank:CB353607 (1) 522 bp
GenBank:AW778181 (1) 488 bp
GenBank:AI641292 (1) 487 bp
GenBank:CD283543 (1) 487 bp
GenBank:AL719714 (1) 449 bp
GenBank:DQ017896 (1) 384 bp
GenBank:EB911503 (1) 342 bp
CITATIONS (2)