header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2577
Transcript Name: mnx1-201
Previous Name: mnx1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013585 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013585|OTTDARG00000011645|ZDB-GENE-040409-1 mnx1|OTTDARP00000011601 CH211-266O5.2-001 LG_ BX247878.5 Danio rerio protein_coding NOVEL, 1010 bp
ATGGAGAAATCTAAAAACTTTCGGATCGACGCGCTTCTGG
CTGTCGATCCACCAAAAGTGCAGACCTCGCCGCTGGCGCT
GGTCACCTCCCTGCCCACCTCATCCATATCCTCCTCTTCC
GACAGCGTCCAGGCGGTGGAGCTGACCACGAACTCCGACG
CACTCCAGACAGAGTCTCCATCGCCACCCAGGATATCGTC
TTGCGGCTTGATTCCCAAACCGGGTTTCCTGAACTCTCCA
CATTCGGGCATGGTCGGACTACACCCTCAGAGCAGTACCG
GGATTCCTCCTCAGGCTCTCTACGGTCACCCAATGTACAC
GTATTCAGCAGCAGCGCTCGGTCAGCACCCGGCGCTCTCG
TACTCATACCCGCACGGTTCCCACCATCATCACCATCCCA
GCGACCCCCTCAAACTCACAGCCAGCTCCTTTCAGCTCGA
CCACTGGCTGAGGGTCTCCACCGCCGGAATGATGCTGCCT
AAAATGGCAGATTTCAATGGCCAGGCGCAGTCGAACTTAC
TCGGCAAGTGCAGAAGACCAAGAACTGCATTCACAAGCCA
GCAGCTCCTTGAACTTGAGCATCAGTTTAAGCTGAATAAA
TATCTATCCAGACCAAAACGCTTTGAAGTGGCCACGTCAT
TGATGCTAACAGAGACGCAGGTGAAAATCTGGTTTCAGAA
CAGGCGCATGAAATGGAAGCGCAGTAAAAAGGCCAAAGAA
CAAGCCGCTCAAGATGCCGAGAAGCAAAAGGGAAAAGGAA
ACCACGACAAAATGGACGGACTGGAAAAGGACTACCAGAA
GGTAGATTCAGGGAAAAGTAACAGAATACGGGACTTTAGG
GACAGTGACGACGAAGAAGGAGATAACTATATGCTGAATT
CATCTGATTGTTCCTCTGAGGATGAACGAACCAATGACAT
AAGTCCACAACCATGAGACCTTATAAAAACGAAAGACTAT
GAGTGAATTATGTGATTTGCATGTATCATCATCTTGCAGT
CAATATGGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mnx1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000013585 (1),  Ensembl_Trans:ENSDART00000052236 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC093243 (1) 1486 bp
GenBank:AY445044 (1) 936 bp
CITATIONS (2)