ZFIN ID: ZDB-TSCRIPT-090929-2496
Transcript Name: hps3-201
Previous Names: hps3-001, zgc:152969-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013395 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013395|OTTDARG00000011491|ZDB-GENE-061110-115 hps3|OTTDARP00000011438 CH211-284E20.3-001 LG_ AL954145.13 Danio rerio protein_coding NOVEL, 3313 bp
TAAGCCACGCCCACTGTAAACACCCTTGTGCTTCGAGCCG
TGACTCTGCCGGATCCGCCCCGGTGTTTGCGCTCACATCT
TCCGTGATTCTCCTCCGTGATGTAGCTACCGCCGGTCCCG
GAGCTGTAGAAATGGTCCACGTTTACAACTGCCACCCTTT
CGCGGCGCAGCGGATCGTGTCGGCGGAGCAGGAGCCTGGG
CTGGTGTGCTGCGGCGGCGGGGCGCTGTTCGTGGTGAGCG
CTGGCGGCTGCAAGATAGAGGCGTTTGACCTGCAGCGGGA
GGAGAGTCCGGTCATCTGCCGGTTCAGCTGCGCGGGGACC
GTGCTCAGCCTGCAACACAGCGCCGTGGGGGATTATCTTG
TCACCATAGAAGAGAAGAACAATGCCACGTACCTGCGGGC
CTACACTAACTGGAGGTACCAGGCCGTGGAGAAGACCCGA
GTCGGGGTGCGTCTGCTGGGTCACCTCCTGCGCGGCTCGT
CCTTCCGCGGAGCTCCTAAAGAGCAGATGGAGATCATAGA
AATCCCGCTGTTTGAGCCGCCGCTGTGTGTGGCCTGCTGC
AGTCTCACCGGTGATCTTCTGGTGGGGAGTGCCAAGAGTC
TGGTGGTCTTCAGTCTGAAGCGGCAGACTCTGAGCGAGCA
GCTGTCGGTGCTGGACTTCGAGAGAGTTCTGATACTGCAT
ATCCAGGGCTGGAGCCCATCTCAGGTGGCCTTTTGTGCGG
GATACCTGGCCCTGCAGACAGAGCTGGAGGTGCTGGTCAT
AAAGCTGGTCCAACAGCAGAAGAGTGCTCAGACTGCTGAA
GAAAACGCTCTGCTTCCTGTAGATATCATGGTGGAGACCA
GCTTAGAGGACGATGCAGAGATGAAGAAAGACGGCTTCAG
CCCGCTCCATGAGCAGGAGGACTTCTTTGTGTTTCCTAAG
CACCAGGAGATGCTGGGTTCTGAAGCGCAGCACTGCGGGA
TCACTTTAGTCCCAGAGTGTACAGCTATGGACTCTGAAAG
TCGAGGAGAAACCACTGTGGTTTACGTTTTATTCAGGAGG
TTTGCGCCTGATTTCTTCCAAGGCTGCAGCGTAGAGGAGA
CACGCTTGCACTCCCTACAGCTCCACCCGATATTTACTGG
TAAACAGGAAGAATCCTCCATCTCCAGATGTGGGGATCCT
GATTGTATGTTTGTTTTCTTCTCCTTGCCCAACACCGGCT
ACATGTACAGCTTAAAGTCTTCAGTGGAGCTCGTGTCCAC
ATACCAGTACCCAGAAAAGGCCCACCAGGCTGTGCTTAGT
GACCAGTTCCTCTACGTCATCACCAGGAACGCTCTGCAGT
GTTTCACCGTCAGATGCAGTGCAGTAGCAGCTCGGGTTCA
GGACCCCTACATCGACACCACCATGAAGGCCTGTCCGCCC
TTCAGCATGGAGGTGTGCGCTCTGCGGATCCAGCTCTTTA
TCGGCCTCAAGGTTCTCTGTCAGGATGGAGATCATATCGT
TCTGCTGACAGCAGCAGATGTGGACAGCAAAGAAAACACT
GAGAGACCGGCGCGCAAAAACACATCCAGAAAGTCGTCGG
TCTGTAAGTCGACAGAGGCGCCGGACAGCGCTCACGGCTG
GAACCTGTATGTGATCAGCTCTGTGTCCACACTGCAGCTC
TACAGAGAAATAGTACTGCATCTCTCCAACCCGTGTTCAC
AGAGCTGTGTTCATCTGCTCAGTGAAGCTCATCTTCTTCT
GCGGTCAGCGCTGCTTAAACTGCAGAACGGCCCTGCTGAG
GAGAAGCAGGAGCTGCTGGAGGCCTTTCAGGAGAGCTGCG
CTCATTTAGGAGACTGTTTCAGCAGGTTTGATAAGAAGGA
TTGTCATTTGGCTCTCCCATATTATAAGATGTCGGGTCTC
ACTGTGACGGATGTTATTCAGAGGAACGTCTCCATGAGTG
GCGTATCAAGCGGTTACGGCCGAGGATTCATCTTCTTCCT
GAAGCATTCGCTGTATGAGGAAACCGTGGAGGAGCTGAGC
AAGGACGTGGCTGATAAAGTACTGGAGATCTTCAGTGTTG
CTGAACCGGCTCAGCTTCCTCATGTTGTGTGCTGTTCATC
AATGCTGAACGCGGACCCTGATGGCGCCGGGGCCCTTCTG
GAGCAGCTGGAGGCCTCCGGGGCCCCGTCCATCACCCTGG
CCCTCTGTAGAGCCTCACTAGCCCTGCGCACGGGAGACCG
TCACACTTACAGCCAGCAGATGGAGCGCCACGCCGAGATG
CTGCAGGTGTATGGCTTCATCGAAGAGCCCCGACTGCTCC
TGCATGGTAGAGGTGTGGGTCTGATGCCCACATTACTGGC
CCAGCAGCTGCGGGACTCTCAGGACGGGCTGCTGGTGGCG
GCGCTCGTGGCCCTGCATGAGAACAGCAGAATCAGCCTGG
AGGACGCACACCTCTTCTTCCAGGAGCTCTGTAAGGACCG
TCTGGAGCCCGACAGCAGTCCGCAGTTATTGGTGGACTTT
TGGGAGTCTCTGCTAGTGGCGTCGTCCCGTGAATCCACCA
TCCAGGAGCTGCTGTTTCGGCTGGTGTCCGTCTACATCAG
CAGGATAACATGCAGCCATCCCAGCGGCTGCAAGGCCCTC
AAAACTGCTGATGACCTGATAAACTCCTGCTCTCATTATG
GGATGTTGTATCCGTGGGTGAGCATCCTTACACCCAACCT
ATACCATGACCAGCAGGAGGACCTGCTCAAACTACAGTCT
CTGCTGTGCGGGCCGACGCTGCAGGTCTCCTCTATTCTGC
CTCTGCTGGAGCCGCTGTCAGACTCCGATGACCCAGGACT
TAGTGTTCATGTGCTCTGCTCCACCAAACTGGGCCAGCAT
GAGGACTCCATCCACAGACTGCTGGACCGCTGCCCACAGG
CCATCATCCCATACGCACAACACCAGCTGCACCACCACAC
ACTGTGTCTGTGGTGGCAGAAACTATTCCCTGAGGTCTGT
GACAGGATCAGGAAAACAGGAAATGACAACACAATCCTCC
TCTCAGCTCTCAAAGAGACTCTGATCGTAGCGGCGAGGGA
ACTGACCCCATTAGAGTTTCTGGATTTGCTGCCGGACGAT
GGAACAGCTCATTTTTTCTTGCCACATCTACTTGAATGCT
GCCAGTGAAATCACATTATTGCAGACAATCAACACTAAAA
CTGCTTTAAAGAGGGTCTTCAGTCCTCCTGCTGCCTTAAA
TGCTGGAGCCCCCCAAAAAAAAGGTTTGTTCATCTCAGAA
GTCACGTGTGAATGCAAAATGACTGGAACTGTGTTCGTCT
TTTAATGAAGTTGTTTACTATAAATAAATCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hps3-201 Contained in:
OTHER hps3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000013395 (1)
  • Ensembl_Trans:ENSDART00000140968 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM315985 (1) 566bp
    GenBank:CB359057 (1) 546bp
    GenBank:BM315657 (1) 390bp
    CITATIONS (2)