header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2493
Transcript Name: map1sa-201
Previous Names: map1sa-001, si:dkey-37m8.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013379 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013379|OTTDARG00000011479|ZDB-GENE-030131-3982 map1sa|OTTDARP00000011424 DKEY-37M8.10-001 LG_ BX005105.6 Danio rerio protein_coding PUTATIVE, 5224 bp
TTTGGATAAACTTCGCAACATGGCGGCGGAGCACATCGGC
GAGTTGGCAAGCATGGAAAACTCGAATCGAGGAGCTCGAC
CCGGTTTCTGCAGCGAGAAATACTCCCTGCTGGTGATCGT
GGGACAGCCAGGGCCGGCGGGGTTCGTGGATTTGCTGGTG
TCGGAGATTGAGAGAGGTTTACGCTCATGGGACGTGGACT
CGAGCGCCTGCAACATTGATGAACAGCTCAAACTCTTTAT
TTCGAGACACTCCGCTTTCTTCTCTGAAGACCTCAAAGGC
CAGAAGACGCTGCAGCACAGCGGGGATGTGCTGGAGACGC
AGGTGATCGTAAACCCATCTCACGATTTGGTTTGTTCAGA
GGTTCGCCGACTCATTTCTGATACGTCTCTTCACAAGCTG
CTAATTCTTGCTGGACAATGTGTTGAGGAGACTGGAGACC
TTGTGCTACAGACAGGGTCTTTCTCATTAGAGGATTTCAT
CCAGATATTTACAGACGAAGAGATTGGAGATCTTCTGAGC
TCTGCAGATCCTACTCAGAAAGCCCGCCTTACTCTGAGCT
GCCCCGAATCTGGCAAATGGAAAACCTCTCAGCTAGAAAA
GCATAATTTGCAAGATTATATAGAGATTAAAACCAACCCC
CCATTAGTGCTCCCCGAGATGGAGGGCCTTCAGGAGTTCA
CCGAGTATCTCTCAGAGTCTCTTGAACCTCAGTCGCCATT
TGACCTGCTTGTGCCTCCCAGTACAGTAGGCTTTCTGAAA
CTGTCCCGTCCCTGCTGCTATGTGTTCCCCGGAGGAAGAG
GCGACAGTGCCTTCTTCGCTGTGAATGGTTTTAATGTCTT
AGTCAATGGCGGGTCTGATGCTCGATCCTGTTTTTGGAAA
CTGGTGAGGCATCTAGACCGAGTTGACTCCGTATTGCTCA
CCCATGCAGGTGTAGATAATTTACCTGGTATAAACAGCCT
ACTTTACAGAAAAGTGGCTGAACATGAAGAAGAACAGTCC
GCTGGATCACAGAGCAGTGACGACTGGCAGAAGAATCTTA
TATCTCCAGAAATAGGTGTTGTATTTTTCAATGCATCAGA
AAGACTCAAGAAATTGCAGAGTGACCCTAGGGTCCTCAGA
AGTTCTGATCAGGTTTCTCTAACATTACAGCATTTAGAAA
AGTTGTCGATATTTCCAGAACGGCTCAGTCGATCTGCCGG
GCCAACTATTGAGCCGGTAATTCTTTTCCAGAAAATGGGT
GTAGGTCGACTAGATCTTTATGTGCTCAATCCAGTCAAAG
GTAGCAAAGAACTAGAGGCTTTCTTGCAAACTTGGCCTGC
AAGTCCTCCAAATATAAAACCCACAGATATTCCTCTTGAG
AGTATAGTGTCTATATGTGCGCTGTTGGTGTGGCATCCAG
CTAATCCTCGAGAAAAGATCATCAGGGTTTTGTTTCCTGG
GTGCACTCCACAGTCCAAGATCTTTGAAGGTTTAGAGAGA
CTAAAACATCTGGAGTTCCTCAAACACTCAGTAGTTAGTT
TGAAGGACCTTGAGGCATCCAAATTGGATAAACAGCCAAA
GCACACCGGGAGCAAGGAAAGCCTTAAGAGTATTTCCAAA
GAATCTCGACCTGGCAGTGCCTTACTCAAAGACAAGGTAG
TCAAAGTAGATCCGAAAAAGCAAGACACTAAAACAAAGAC
TAAACCCACTAATGAAAGTGAAGAAAAGGCAAAGCCAAAA
GATGATGTGAAGCTGAGACCTAAGACTGCTGAAAAGCAAG
TAGCTAAGAAAGAACCTGCAAAAGATGAGAAAAAGGAAGT
GAGGAAGAAAGAGGAAAAGCCGCCGACAAGTATTGCAAAG
AAAGATGAGCATGTGGAGAAAAAGAAAGAACCCTTGAAAA
AAGATCTTGGTGCAAAGCCCAAGAAAGATATTGTTAAACC
TGATCTAAAAAAGGAGATTAAGAAAGAGGTCAAACCAGAA
AACAAAAAAACTACCAAACCTCCTGTCAAGGAGGTTAAAA
AACCTGCTGGAAGTTTGCCTGGGAATACAGAGTCTAGAAA
GTCAGTTGGCAAGAATGGCTCTCTAAAAAAAGACGTATTG
GTCTCTAAAAAGGATCCTGTAACTAAAGGGAAACCAAAGC
CAGACAAAAAGGAGCCTGACAATGTGAAGTCCTCAAGTGG
GGACAAATCAAAGACATCCACGCCTGAGGACATTTCTAAA
CAATTAGAGAAGTTGAAGTTGGATAATGAACATGGGTCAC
TGCAGGATGCTGAGGGAAACAATATGAGCTCAAGAACTGC
CTCTGACTGCAGCGCTGGGCAAGTGAACGGCTCTAAAACT
GGTACTGAGGAAAGTCCAGAGAAGTTTCGGAGTATGGATG
GAACTCCCGGCTCAAACAACCCCTCACCACTTACCAAGAC
TCCAAAGAGTGAGAGAAGTGTTAATTTTGATCTCACACCA
ACAGAGCTTGATGGATGCCTCAAAGAGGATGCCTGTACAA
GCTCGGATGAAAAAACTCTTGAGTTAGTTTCTCCTGCAGA
CTCCGGGAAGAACAGTTCATGGCATACCCGTTACCCACAA
TCCCCGGACAATGCTTGTCTAGATTCTAGTGAAGATTGTA
AGGTAGGCATCAGGAAGTCTGGTCTTGCTGTGGAAGACGG
TCAATTGGGAATCTGCAAGAACTCTAGAAGCAATATTGAA
AACAGCTCCATATCGTCACAAGATCGACAATCAAGCTTTC
TCTCCTCAACTTCATTTAAAGACGGCTCTACCAGCATCAC
TTCCTTCCCCGCGGAAGTAGGCTCTCCACACTCCACTGAA
GTAGAGGACTCTTTATCGGTTTCCTTCGAACAAGTGCCTG
TTTGTCATCCTCAAGAGGAGATGGGTAGTCTAGCGTACAC
TAATGGACATCTAGCAGACCGTGACCCAAAAGCAGATATG
TCTTTACCTTTAAAAACATCTCACAATAGTCACCATGCAT
ACGATGACTCTGAAAATCACCTTTATGGACTACAGGGTGA
CGTTCTGCCTCATGATGTCGATCTATGTCTGGTTTCACCT
TGTGAGTTTAAGCACCACAAATCTCTGGAGAACCAACAAG
GATTGTCTTCGGAGGTTGCCGCCCCGAGTCCTGACCTTTC
TCAGGAGCCACTTAGAGATCACCAATCACAGGAGACCACA
TCATCTGTAAGCGTCTCTCTTATTTCGGTTTCTGATTCTG
ACGTGCCGCCAGCCACTGAAGAGTGTCCTTCTATTAGTGA
GGAGTTGGACTCTGAAGAGGACACTACTAGTGATTTGTTT
CCACCTCACCATCCAAGCAGTCACTCGTTACACCACAATT
CCCAAGACCCTCCGCCTGCCCCAATGAAGGATTTACCACC
GCTGCCACCCCAACGCGGTGCCTGCATGGCTGACCCTGAG
GCTGACAGTCAGGGAAAGTCTTCCAAGAATGTAACTGCAA
AGACCAAAAAAACTGCAGCAGCAGCTCCCACAAAGACGGG
ATCTGCTAATGTTGTAGCACAGACTGGGAAGACAAAGATT
GGTGGTCCGGTGTCTGCAACTGGGACTATTCGGGTAACAT
CGAGTTTGGACACCAGACCTCCGTCCCGCAGTGCTATTGG
TGGATCTAGGCCAACGTCTTCCAAGTCCTCATCCACTCAT
ACAGTGGATGTGGAGTTTTTCCGGCGCCTCCGCTCATCCT
GCTATATAATTAGTGGAGACGAGCCACACAAGGAGACCGT
CATGAGGTCTATTCTGGACTCCCTGCTGGAGGGCAAAGCG
TCCTGGCCCGATGTGCAGGTGACTCTGATCCCCACATTCG
ATTCGCTGTCGATGCACAACTGGTACCAGCAGACCCACGA
GCGGCAGAAAGATCTCTCCATCACCGTCCTCGGCAGCAAC
AGCACGGTGGCCATGCAGGACGAGACCTTCCCAGCATGCA
AAGTGGAGTTTTAGCCAACCGCACCCCTGCCTGTCACTAC
AGCACTTCTCTGCGCTCGGTTCACACACTCGTTTTGACTC
CGCAGCGGCTCTGTTCATCCCTCATGACTTTCATCTGCAG
CATCCACATAAATTATTACAGATTCTGCATGAACGGGGTC
GACTCTTGCCTTTTGTATGCCCAGTTTTTAGCAGTTTTAT
GGTATTTTATGTAATCCATCGCATCTTGTTGGATATCTAG
CACGTTGGACAAGAATCAGCAGCAGTTTCTCGTGGTCCTA
CATTACAGTTTGCACAGAAGACACACATTGGGAAAGTACA
ATAGGGTTTGACTGGTTAGGGTTAGCTTTGACTGCACTAA
ATGTTAGTTAGAAAATCGGGCCAATTAAAGTATTATGCTT
TTGTTTAACAGCATTAGGAGAACAGAAATAGCCTTGCCGT
CTCTATAAACATGTCACTAATATACCGGTACATCAGTTTG
TACCTAAAATAGATTAAAAGCTTCGACGGAAAGTGTGGTT
TCAGAATATTAGGCTGTTTCTGTGTATCGAATACAAACAC
TATGTGATTATTTTTGTGACTCATATTACAGTATGTAGTA
AAAGCCAATATTCTGCGTTTGTTTAGTGGAAAATAGTGTA
GGTTTTTATTATTTTGGCCACTTAATTGTTTTTTGGTACC
AAGATAAACGCCTTATTGTTTCGCCATCATCAATCAACAC
TAAGCATCAGCATGTCATTCGTATCACTTGATTAGATCAC
TTGTTTTTGATTTGCTGGATGTCGTGCAGACAGCTCAAAT
GCTGAGCATATTATCACTGCTTTAGCTGCTGTAGTTTCTG
CTAGATAAATAATTCCGGTCGTATTTCCATTACACACTTT
CTTCGTTATTTTGGACCTTTATGAAGTCGTTAGTGTTACC
GTTAATGCTTTACCTTTTCAGAATTGCACTTTTATTTATT
TTAGTTTTTCTTTTCTGAGCCGATTACTATTTTTATGAGG
TACAACTAGTTGGTTTTGGATTTTTTTGTTGTTGTTGTTG
TTTAAATGCATTTTGTTTTATACATATATATATATTCCTT
ACAAGAAGAGACCAGCCAAATAAATAAGTAAATAAACGAA
TATTACAGCAAACGTGTGCTTGATGTCACTAATAAATGTT
TCAGAGCTGAATTTCGAAATTGAAGCAGTTTTCAAATCAC
AAATAAAGCTGATAAGTTAAGCTGTACAGTCTCTCTTTCT
TCCTGCAGTGATGTGAGGATTAAGAAAATACACAGACACG
TAAATAATAAAAGTGGAGTTTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
map1sa-201 Contained in:
OTHER map1sa-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000013379 (1)
  • Ensembl_Trans:ENSDART00000086064 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK029514 (1) 769bp
    GenBank:CF348085 (1) 744bp
    GenBank:BM957715 (1) 692bp
    GenBank:BG727847 (1) 560bp
    GenBank:CD580742 (1) 319bp
    CITATIONS (2)