header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2492
Transcript Name: si:dkey-37m8.8-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013378 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013378|OTTDARG00000011478|ZDB-GENE-050208-530 si:dkey-37m8.8|no_translation DKEY-37M8.8-001 LG_ BX005105.6 Danio rerio processed_transcript NOVEL, 860 bp
CTTTCTTTAAAATGACCCAGTCCAGTCGCTCCGTCCTCCT
GCTGATGCTGTCTTCTCTGCACTGCCTGGGAAGTTCTCTT
GAGTCAAACCCTAAAGACCCTTCAGTTTTGGCGGAAGCCC
CTGGCCAGAACAAAAGAGATTCTGACATTTCTCTTGTGCC
TCAAATGCCCGTCCTTCAGCCCAAAGAAACAGCACCGCCT
CTGGTCACCTACACCATAAGAAACCCTCAAGGCAAAGTGT
GTGTGAGGGCCAGTTTTGGAGTGGAGTTCGTGGTGAGAGA
GAACAAAAAGAAGTATTATTTCAACTTGACTCCTAACTCA
GCACGGGCCACAGGATACTGTGCGAACCAAAAGACCGTCC
TCTCACTGGAGTTTTCTGGTGGAAATCTGGAGTTTACTTT
CATCAAGGATGGGGATCAGTCCTATGTGAAGACTGTCAAA
GGTTCTCTGAGAGCTGCTCCTCCTTGTAAAAACTGCCCAA
GTAAAATCTATGTAGGACTGGTGGATAACGAAAAGTTGTT
CAAAGCAAAAAATGGCCTGAGCTTCAACTGCAAGTCTGAG
ACGATGTTGATACTGGCAGACTACTTCAGACTTAAACTGG
TGCCACTGCAGATTCAAGCCTTCGATCTGGTCAATGGGGC
ATTTGGAAAAGAGGTTGAATGCTGGGCGGATTACAACAAG
CGGATGATCCCGATAATCCTAGGGGCCGTAGCTGCGGCCA
TTTGCCTCATAGCCATTCTGACCTATGTGCTCGTCAGAGA
ACATCGAAACCAAGGGTATGAACAACTCTAAGACTCTAGA
TGCGGATCTTGAGGACGAATCACTAGATCTTGAGTTTTGG
ATTTTGTGATATTGCTTCAC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-37m8.8-001 Contained in:

OTHER si:dkey-37m8.8-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000013378 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB989869 (1) 570bp
    GenBank:AL915852 (1) 317bp
    CITATIONS (1)