header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2491
Transcript Name: mccc1-201
Previous Names: mccc1-001, zgc:154106-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013377 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013377|OTTDARG00000011477|ZDB-GENE-050208-450 mccc1|OTTDARP00000011423 DKEY-37M8.6-001 LG_ BX005105.6 Danio rerio protein_coding NOVEL, 2740 bp
ACTTAACGTGTTTGCTATCCACCGGCTACACGTAGCACCG
CAAATATTATCGTTTTAACCACAGCGTAAACAGAAAAATT
AAACAAAATACCAATGTTTAGAAAAAATACATCAACTATA
TAAAATATATGAGTGAAATTTATGAAACTGATGCGCTGTT
TTAGTGCAGGAGTCGCGTAGTTACAGTTGTTCTATGCTAA
CACAGTGACCATGGCTGCCGTGTTTTTGAAAACTCACATC
AACGGAACTATAAACAAACATCTGCTGACGCTGATTTGGA
CCAAAGGATCCGTCAGACATGGCTCTGTGGGCCGGATCGA
GAAGGTGGTCATCGCTAACAGAGGAGAGATCGCCTGTCGG
GTGATGCGGACGGCGAGGAAGATGGGGGTTCGTTCGGTCG
CGGTTTACAGCGACGCAGACAGACATTCCATGCATGTGGC
CATGGCGGACGAGGCGTATCACATCGGTCCAGCAGCGTCT
CAGCAGAGTTACCTGTGCATGGACAAGATCCTGGATGTGG
CCAAGAAGTCATCTGCACAGGCGGTTCACCCTGGATATGG
TTTCCTCTCTGAAAACACTGAGTTTGCTGAACAGTGCAAA
CAGGAAGGCATCATCTTCATTGGGCCTCCATCATCAGCCA
TTCGGGACATGGGCATCAAAAGTACATCCAAACACATCAT
GTCAGCTGCCGGCGTGCCAATCATCGAGGGCTACCATGGG
GACGACCAATCAGATGCGAGACTTCAGAGCGAGGCAGCGA
GGATTGGTTACCCTGTGATGATTAAAGCGGTTCGAGGAGG
CGGCGGAAAGGGAATGCGAATCGCGCAGTCTGAAGCAGAG
TTTCATGAACAGCTGGAGTCCGCAAGAAGAGAAGCTCGCA
AATCCTTTAATGATGACGTGATGCTGATTGAGAAGTTTGT
TGAAAACCCCAGACATGTGGAGGTGCAGGTGTTTGGAGAT
CAGTATGGGGACGCTGTGTATCTGTTTGAGAGGGACTGCA
GTGTTCAGAGACGACACCAGAAGATCATCGAGGAGGCTCC
GGGGCCAGGCATCAGTCCTGAGGTCAGGAGGAAACTCGGA
GAGGCCGCGGTTCGAGCAGCTAAGGCAGTCAACTATGTCG
GAGCAGGAACTGTGGAGTTCATCATGGACGCGCAGCACAA
TTTCTACTTCATGGAGATGAACACACGTCTGCAGGTGGAG
CATCCGGTCTCAGAGATGATCACAGGAACTGACCTAGTGG
AGTGGCAGCTGCGGGTGGCCGCAGGAGAGAAGCTTCCTCT
CTCTCAGGAGCAGATCGAGCTGCGAGGTCATTCGTTTGAG
GCCAGAATCTATGCAGAAGACCCCAATAACAACTTTCTTC
CCGGAGCAGGACCTCTGCTACACCTGTCCACACCACCGGG
AGACCACAACACTCGCATCGAGACGGGGGTCCGAGAAGGT
GATGAAGTGTCCGCTCATTATGACCCGATGATCGCTAAAC
TGGTGGTTTGGGGTGAAGATCGTTCAGCCGCTCTGAAGAA
GCTCAGATACTGCCTGCGACAATACAACATTGTGGGTCTC
AACACCAACATCGACTTCCTGCTGAGTCTGTCGGGACACC
CAGAGTTTGAGGCGGGGAACGTTCACACCAGCTTCATCCC
GCAGCACTACGATCATCTGTTTCCACCCGCTCAGAGTCCG
TCAGGAGAGGTGATCTGTCAGGCGGCGCTCGGCCTGCTGC
TCCGAGAAAAACAGCAGACGCAGAAATACAGAGAGCAGAC
CAGCGATGTGTTTTCTCCGTTTGCCTCCAGTAACGGGAGA
CGTTTGAATGTCCTGCAGTGCAGAAACATGAGCCTGCAGC
TCGGAGACAACAAAGTGGCGGTATCAATTACCTACAACCC
TGATGGCACATACAGTATGGAGACTGGCGGTCGGGTGTTT
GCTGTATCAGGAGAGCTGCAGCTGGAGGGCGACGTGACGT
ACCTGTGCTGCTCCGTCAATGGAGTTCTGTCCCGACCCAA
ACTGGTCATCCTGGACAACACCGTACACCTCTTTTCTATG
GAAGGAAGTGCTCAAGTGGACGTCCCAGTGCCCATGTTTC
TGGCAGGTGTCAGTGGCTCCAGTGCACAGGGTGGCGCTGT
TGCACCCATGACTGGCACTATTGAAAAGGTGTTAGTCAAG
GCTGGAGACTCGGTCCAGAAAGGAGATCCGTTAATGGTGA
TGATTGCCATGAAAATGGAGCACACCATCCGCGCACCCAA
AGCCGGCGTCATCAAGAAGGTGTTCTTCAAGGAGGGCTCG
CAGGCCAGCAGACATGCAGCTTTGGTGGAGATGCAGGAGG
AAGAGGAGGCCGCTGGAGAAGAGTAAAGACACACCATGAT
AAATACACTTAGATTAATCCTCATTCAAATCTAGAGAAGC
ACTACACTTTGGAGCTTGAGATATTTAAGAAGCGAACTTA
AAACCGTCTTGATTATGTAAAAGCATTTGGAGTCACCTGT
AGCTTGCTTTGTGTGGATTTCAGTCCCTGATAGTTTAGTG
TTTTAGTCATTATTTTATACCATTTTTTTGGTGGATGAAC
ACAAAAATAACCACACACTTATAAACAAAACCTGCTCTCT
GGTGTTGTTGGATATCCCTTATATATTACCGATAATAAGC
GTTGGTTAACACACTGATTTGTGGTGGAAAAGGTGCCTTG
ATGTTGGTTTGAAAAGAATCTGTAACGATTTACACTCAAT
CATTAAAGAGTTTTTTTCTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mccc1-201 Contained in:
OTHER mccc1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000013377 (1)
  • Ensembl_Trans:ENSDART00000158293 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK146800 (1) 817bp
    GenBank:CK019403 (1) 813bp
    GenBank:CF996578 (1) 758bp
    GenBank:BM096297 (1) 649bp
    GenBank:AW232055 (1) 644bp
    GenBank:CF102744 (1) 594bp
    GenBank:BI886090 (1) 581bp
    GenBank:CF102458 (1) 579bp
    GenBank:CB359820 (1) 536bp
    GenBank:AW184352 (1) 265bp
    CITATIONS (2)