ZFIN ID: ZDB-TSCRIPT-090929-23206
Transcript Name: ottdart00000001797
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001797 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001797|OTTDARG00000001683|ZDB-GENE-000823-6 hoxb5b|OTTDARP00000001585 hoxb5b-001 LG_ AL645798.2 Danio rerio protein_coding KNOWN, 1356 bp
CATTGAGTTGAACCAAACGATCATCATTTCGTCATCATTT
GTAACCATAGAGCATGAATTACCTCTTGAAGTCATCAGAG
AGAATTTACGACTGGTCAACAAAGGCACGTGATGCCCTAA
CGCTCTCCCATATTTGGCCGCATACATGGCAAAAACGAAG
TACAGTGCATTGCTATAATTCATTATTACATCATAAATTG
TGCGGCGCTGGATTTTAACGACCAAGATCTACAAATCAAG
ACATTTTAAAACATCCAAATGAGCTCTTATTTTCTAAACT
CGTTCTCAGGGCGCTATCCGAATGGGTCTGACTATCAGTT
ACTAAATTATGGTACTAACGGCGCTATGAACGCTTCTTAC
AGGGACTCCACCAGCATGCATTCCGGGTCTTTCGGTTACA
ACTACAATGGAATAGACCTCAGTGTAAACCGTCCCAACAA
TGGCCATTTCGGGGCAGTTGGAGATAATTCTCGCGCTTTC
CAAAATCCGAGTCAGGAGACCCGGTACAGACAGTCGAGCT
GCTCTCTCTCGTCTCCAGATCCTCTGTCTTGTGCCACCAG
CGATACTCTGGAATTGAAGGGTTCCTCTCCTCCATCTGAT
CAGAGCACACCAACCGGCAACAGCAGACTTACCAACAGCA
ACAATCTTACCAGCAGCAATAGCACACATTTTGCGGACAC
AGATGAAACCAATGTCTCGTCCGAGACCGAGGAAGGAGCA
CAGACCACCACCACCAGTCATACGCAGAAGCAAGAATCTG
TGGCGACCTCGACTACAACACCTAACGACGGTCAAACTCC
ACAGATATTCCCCTGGATGAGGAAGCTGCACATTAGCCAT
GATATGACTGGACCTGATGGAAAACGGGCTCGAACAGCTT
ACACTCGCTACCAGACGCTCGAGCTGGAGAAAGAGTTCCA
TTTCAATAGATATCTGACGCGCAGGAGGAGAATAGAGATA
GCTCACGCTCTCTGCCTCTCAGAGAGGCAAATCAAAATCT
GGTTCCAAAATCGCAGGATGAAATGGAAGAAGGACAATAA
ACTGAAAAGTATGAGTCTCGCTACAGCGGGGAGCGCGTTT
CAAAATTGATCAAATCACATCACATCAATTGGAAAATTCG
ACTACTGTTACAGCGCTGCACCTTCAGCTTGTTCTCACCT
GACGACGTGTGATTCTCCCGTGCAACTCAAAATTGTCAGC
TGTTGAATGTTATCATATGCTAAACTAGTTACAATTGCCA
TAAAATGAGTGTGAATGTCAAGTGTGTCAAGTTTACACAT
TCGTGGAGGAAAGCATGTTCCATGTGAGCTATTCGTGCAA
CGTATTAGATCTACAAAAATTATGTACAGTACAACT

hoxb5b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxb5b-201 (1) 1626
ottdart00000001797 1356
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001797 Contained in:
OTHER ottdart00000001797 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001797 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BG985723 (1) 678bp
    GenBank:Y14526 (1) 400bp
    CITATIONS (1)