Transcript

si:busm1-40g1.16-001

ID
ZDB-TSCRIPT-090929-23180
Name
si:busm1-40g1.16-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001600 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001600|OTTDARG00000001489|ZDB-GENE-030616-458 si:busm1-40g1.16|OTTDARP00000001407 BUSM1-40G1.16-001 LG_ AL591674.3 Danio rerio protein_coding NOVEL, 342 bp
ATGGACACATGCTTTATACTGATTCTCACTCTGGCCACCA
CAGGTTTGGTGTGTGGAGACAGCATTGAGCCAGATAAAGG
GACAGAAAAAAACTCTGAAGAAACAGAAAATGTCAAGCTG
AGCTGCTCATATACTACAAGCAGTGAATATGTTAGGCTTT
ACTGGTACAGACGGTATCTCACTGGAGAACTGCAGTATCT
ACTACGCAAAGGTGCACGATCATATAGTGCTCATCACACT
TCTGATAAACGGTTTCAGACGGCTACATCACTTTCATCCA
CTGAACTCACTATTACTAATGTGAGTCTGTCAGATTCAGC
TCTCTATTATTGTGCTCTCGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations