header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-231
Transcript Name: stxbp6l-202
Previous Names: stxbp6l-001, si:dkey-63j12.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000004218 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000004218|OTTDARG00000004037|ZDB-GENE-040724-16 stxbp6l|OTTDARP00000003829 stxbp6l-001 LG_ AL954679.7 Danio rerio protein_coding KNOWN, 2515 bp
GACTTTCATTAGACTCTGTGCGGGATAAAGATGGCTTGAG
GTGCTGACACACTGATCTGCTGCAAACTTCTCACTGCTTA
TCTGGGCTCCAGGAAGGAAGAAATCGACTGAAGATCAAGC
AGAAGGCATTTTGAAGATGAACATTCAGTCAGCCATCAGT
CGTGAGATTTTTGTCCCAAGAGATGAAAAGTTACTGGTTT
CCATTGAGGTGAGGAGGAGGATGAAGAGGACGGGACTTTC
CCTCAAAGGGCGCAATAAGAAGTACTTGACTTTCCTCTGC
TTGTCAGTCACCAACAGCAGACCAGCTAAAGTCTTCATCA
CTAAAGTGAAGAAATTCCAAGGCGCGCGGCAGTATGCTAA
AAGATCTCAGTGGTCTGTGGAGCAGCTTCGCCAGGTCAAT
GGCATCAACCCTGATAAGGACACTCCTGAGTTTGACCTAG
TGTTCGACCGCACCACCGACCAATGGGAGGCCAGCTCAGC
CGCAGAGAAGTGCATGTTTGTGCAGGTTTTGTACCATGCA
TGTCAGAACTTCTGGGAGGCGAAGCTCAGCCAGGAAAAAC
CAACATCCCCTGGAGGCCAGAAGACACCAGGAGCTGTGGA
GAGCAAGAAGAGCCCTGCTGCAACAAACCAAACCAACTTC
ATCAACTGCCAGCCGAAGCTGATGGGAGATGCATGCTCTG
TTAATATGGTCATCTACCGCTGCAAGATATTTTTGAATAG
AATGAAGACCAGTATGACTGCAAACCAAGATCGGCGTCAG
CGTGAAGCAGGTAAATCCTCCAGGAGCAGAAGCAAGAGCA
GTCCATCTCCTCCAGCAGTGAGAAAGATGGGGAATGTGAT
GCGGAGGGCCAGTCAAGTGTTGAGTGAGCGAGGTGAGCGT
CTGATGAAGGCTGACGACAAGACCAGCCACATGCTGCACG
GGGCCAGACATTTTGCAGAGGCTGCTCAGAGGCTGGCTCT
GAAGCAGATCTAAAGGTATTCTGGATGCCCTTTCTGCCAA
TAAACACGCTAAAAATGAGCTTTTAATCATCTGGTTGCTG
GATAACTTAAAATAGTAGCTATTTGTCTAAATCATTCTGT
GCAACACTTTTTATTTAGCTTTCTCCTCACCTGCAGACTG
AACTCATATTTCTGCATTCTTATTTTTGCAAACCACTGAG
AAATTTAAGCAATTGTAATGTGTTCAGTCTGACTCGCAGA
TCTGTTCACTTTTTTGCCATTTCTACAGTAATCACAGGAT
AATATAGCCAGCAGGAGGTTGATCCTCTTCTGCTGAGATG
CGTAATACCATGAGACGAGTGAAATTATATTTGTTTTGCA
CTGGTAGGAGCCTTAAGCCTTTTGATTTTGCTCGCAAAAC
TAAAGAAAATTGCCTGCCTCAAGGTAAAACACAAGATCAA
AATGAAAGCATTACAGCACTTTTGCAATAACTCTTTTGTA
GTTTTATCTATGCAAGTTGTTTCCATTTTTATAGTTTTCT
CACATAGTTTGGTATTTATAAGGCTGAGACTCACTCTTGT
GTAATGTTTATATTAATTTAAAGCAGGTTTAGCACTTTAC
TGTATAAGGTAGCTTATTGGAAACACTGTTTATTTCCCTA
AAACGTTAACAGTTTTGTAATGTATGTCATTTTAAATATT
TTAGTACTTATAGCTTAATGATGCTACTCCTATAATATAT
ATTTTGTACATATTTAACTGGGTTTCAGACAGATCCTGAT
TGCCCACATGCTAATGGTCTATTTAAAATAAGTAAAGCAA
CTGTATGTATTTTGAGAAAGCCCTCTACACTTCTGTGTCC
ATTATATTGCTTTTATATTTCAGTAGATATGTGTGTTCAC
AACTTGTGGCTACTTAATTTTTTTTCCATACAAGCTCACT
AACAAATTAACTAATTTATAAAAAGAGAGAGAGAAAAAAG
ACAAGAAACAAAATCCAGTCACCTTATTAGAATTAAAAGG
ATTAATCTGGTAATTAAGATAAACACTTGCATATACTTTA
TTTATGTTATTTGTGCACAAGTGTTTCTCCATATATCACA
TACAGTACAGGTGAAACACTCCTGAATGATTTTCAGTCAT
CACAAACATGAGATTAGAGATTCTATAAGCTTTTTTCATT
ATAAAAACAATGTATTTAAATGTGATCTGTGCGACATGAT
TTTTTGTTCTTCCCTCAGTCTTGGTCTTGTAATTCTGTGA
TGTTGTGATAAGACTCAGCTTTGTGTTTGTGATCGTGATC
CTCATCAGCATGTCATAAAGAGGCCAGAGGGTGTTTTCTG
CATCGATTCAGACACCCTGTTTGGTGTTGACGTGTGATGC
TGCCTGATTGTCTGTCTCCTTATGCTGCTATTTTTCTATG
AGTGTTATAATGCCTCTTCAATGTATTTATGCTGCATAAT
AGAAAATGTGTAACAGATAATTCTGTCCTTGTCTTTGACT
GTGCTCTTGTCTGCACTTTAAACATGTTAAATGTGAAAAT
ACCCATACTTTGCGCAATAAATGAAATGGGACACA

stxbp6l TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA stxbp6l-201 (1) 783
stxbp6l-202 2515
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stxbp6l-202 Contained in:
OTHER stxbp6l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000004218 (1)
  • Ensembl_Trans:ENSDART00000080691 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK400828 (1) 833bp
    CITATIONS (2)