header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22798
Transcript Name: tuba1c-201
Previous Names: tuba1c-001, tuba1l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030167 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030167|OTTDARG00000023193|ZDB-GENE-061114-1 tuba1c|OTTDARP00000024577 DKEY-18F23.9-001 LG_ BX465853.12 Danio rerio protein_coding NOVEL, 1682 bp
CCCTTCATCCTCCACACAGACTGCCTCAATCTTGGACAGT
GGGTTCACAGTTACTCCCGACAATATAGAATTTTCCTCCT
GCCTCCTGACATCCGTCTCATCGCTCCATCCCTTCCAGAA
TAATGCGTGAGTGCATCTCTATCCACGTTGGTCAGGCTGG
AGTTCAGATCGGCAATGCCTGCTGGGAACTGTATTGTCTT
GAGCATGGCATCCAGCCGGACGGGCAGATGCCCAGCGACA
AAACCATCGGAGGTGGCGATGACTCCTTCAACACCTTCTT
CAGTGAGACCGGAGCTGGAAAACACGTCCCCAGGGCTGTC
TTTGTAGACCTGGAGCCCACTGTCATTGATGAGGTGCGCA
CTGGGACATACCGTCAGCTGTTCCACCCTGAGCAGCTCAT
AACAGGAAAGGAAGATGCTGCTAATAACTATGCCCGTGGT
CACTACACTATTGGAAAGGAAATCATTGACCTGGTGCTGG
ACAGGATTCGCAAACTGGCTGACCAGTGCACAGGTCTCCA
GGGTTTCCTGGTCTTCCACAGCTTTGGTGGTGGCACCGGT
TCTGGCTTCACCTCTCTGCTGATGGAGCGTCTGTCTGTCG
ACTACGGCAAGAAGTCCAAGCTTGAGTTCTCCATCTACCC
CGCTCCTCAGGTCTCCACCGCTGTGGTAGAGCCTTACAAC
TCCATCCTGACCACCCACACCACCCTAGAGCACTCTGACT
GTGCCTTTATGGTAGACAATGAGGCCATTTATGATATCTG
CCGTAGAAACCTTGACATTGAGCGCCCTACTTACACCAAC
CTCAACAGGCTGATCAGTCAGATTGTGTCCTCCATCACAG
CCTCCCTTAGGTTTGATGGTGCCCTCAATGTGGATCTCAC
TGAGTTCCAGACCAACTTGGTGCCCTATCCTCGTATCCAC
TTCCCTCTGGCTACCTATGCCCCAGTGATCTCCGCAGAGA
AGGCTTACCATGAGCAGCTCTCTGTGGCTGAAATCACCAA
TGCTTGCTTCGAGCCGGCCAATCAGATGGTCAAATGCGAC
CCACGTCACGGCAAGTACATGGCCTGCTGTCTGCTGTACC
GTGGTGACGTGGTGCCCAAAGATGTGAACGCCGCAATCGC
CACCATCAAGACCAAGCGCACCATCCAGTTTGTGGACTGG
TGTCCCACTGGTTTCAAGGTTGGCATCAACTACCAGCCTC
CCACTGTGGTTCCAGGTGGTGATCTGGCTAAAGTGCAGAG
GGCCGTGTGCATGCTGAGCAACACCACAGCTATTGCTGAG
GCCTGGGCTCGTCTGGATCATAAGTTTGATCTGATGTACG
CCAAGCGCGCCTTTGTGCACTGGTACGTGGGTGAGGGTAT
GGAGGAGGGCGAGTTCTCTGAGGCCAGAGAGGACATGGCT
GCCCTGGAGAAAGATTATGAGGAGGTTGGTGTCGACTCCA
TCGAGGGTGAGGGAGAGGAAGAGGGCGAGGAGTACTAAAA
TATTCACTAAATGTCTAAAACTGAACACAGTAGACCGCTA
ATTTACACACGATAAACATGAGGTATCAAGTGTAAAGTCT
ACTCCTAAATGTTAGAGACACATTCTTGATCAGTTGTTGT
GTTGTTATGGCCAGTATGCTTATTATTTGTGGAATTTGCT
TGCCAAATTTGGAATAAATTGATGGTGATGTGCTACAATC
TG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tuba1c-201 Contained in:
OTHER tuba1c-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030167 (1)
  • Ensembl_Trans:ENSDART00000077539 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC151891 (1) 1686bp
    GenBank:BC042319 (1) 1647bp
    GenBank:DT866332 (1) 782bp
    GenBank:AW280055 (1) 633bp
    CITATIONS (2)