Transcript

yif1b-202

ID
ZDB-TSCRIPT-090929-22759
Name
yif1b-202
Previous Names
  • yif1b-002
  • zgc:103562-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039672 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039672|OTTDARG00000028968|ZDB-GENE-041114-16 yif1b|OTTDARP00000031723 ZFOS-464B6.1-002 LG_none BX663503.10,CU571396.4,CU651659.6 Danio rerio protein_coding KNOWN, 898 bp
CCGAGTTTTCCTGCCGCTGCTAATTTTAGTTTCTCTACAC
CGGCAGCTTGTCGGTTACAAGTCTAAATGTGTGGATAAAT
ATTTATATATGTGTCTCGTAACTATTTAACAACGTATACC
ATTGAGGGGAGAGATGATGGAGTACCCGAATCAGAGTGGG
TTCAGACAGCTGCCGCAGGTCAGGATGCGAGGGTCCGCGA
TGGAGCCCAGTGACCCCACACAGTTATTTGATGACACCAG
TTCCGGAGTGAACAAACATGAGCCCGGCAGGGTCGGAAAA
AGCCCCGATGTGTTTTCAGGACAGAACCTGCTCTCGGACC
CCATGTCAAACCTCGCCATGGCCTACGGCAGCAGTCTGGC
ATCCCACGGCAAAGAGATGATGGATAAGAACCTGGACCGT
TTCATCCCCATCTCTAAGCTGAAGTACTACTTTGCAGTAG
ACACTGTATATGTTGGAAAGAAACTCGGATTGCTGGTTTT
TCCCTACATGCATGATAACTGGGAGGTGAACTATCAGCAG
GACACACCAGTCGCTCCACGCTTCGATATCAACGCCCCTG
ACCTCTATATTCCAGTGATGGGATTCATTACATATGTCCT
GGTTGCAGGCCTGGCTCTGGGCACACAGAACCGGTTTTCT
CCAGAAATTCTGGGCATTCAGGCCAGCTCAGCATTGGTGT
GGCTCATTATTGAGGTTTTAGCTGTCCTTCTCAGTCTTTA
CCTGGTAACGGTTAACACCGACCTCACCACCATCGACCTG
GTGGCCTTTTCCGGATACAAATATGTCGGGATGATTGTGG
GAGTGGTTGCAGGACTTCTGTTTGGACGGATGGGATATTA
CCTCGCTCTGCTGTGGTTCTGCGCCTCCATTTTTGTCTTC
ACGATTCGTACGCTGCGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations