header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22630
Transcript Name: hoxb8b-001
Previous Name: ottdart00000001795

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001795 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001795|OTTDARG00000001681|ZDB-GENE-980526-291 hoxb8b|OTTDARP00000001583 hoxb8b-001 LG_ AL645798.2 Danio rerio protein_coding KNOWN, 882 bp
ATGAGTTCCTACTTCGTCAATTCCCTCTTCACTAAATTTA
AAGGAGGCGATTCTCTGCGCTCCAACTACTATGACTGCCC
AAGCTACACGCCGGATCTTGGAGGCAGACCATCTGTGCTG
TACGGTCACAACACAGGATCTGCGTTTCAGCACGCGGCTC
AGTTCCCGGATTTCTACCACCACGGCACATCATCATTCCC
CCACGCGTCTTACCAGCAGACCCCGTGCGCAGTTGCGTAC
CCTGGAGATGCCACGGGAAACATCTTGGGCCAGGACGGTT
TACAGAAACAGTCGTTCTTTGGCGCGCCAGATTCGGATTT
TACGCAGTTTGGGGATTGTAATTTAAAGGTCAGCGGTATC
AGGGATGATCTGGAGAGTGCAGAACCGTGCACAGCGCAAC
TCTTCCCATGGATGAGACCACAAGCTACCGGACGGAGAAG
GGGCAGGCAGACCTACAGCCGCTACCAGACGTTGGAGCTG
GAGAAGGAGTTCCTATTCAATCCTTACCTGACCCGTAAGC
GGCGCATCGAAGTGTCTCACGCACTGGCCCTCACTGAGAG
GCAGGTAAAGATCTGGTTCCAGAACAGGCGTATGAAGTGG
AAAAAAGAACACAACAAAGACAAGTTTCCCAGCAGCAAAG
CAGAACAAGAAGAAATTGAGAGAGAGAGGCAAGAGGGGAG
CCAGGTGTCAGAAAAACACACATCTGGAGAAGAGGACTCG
GAGGCTTCTAGCAATTCTAAATAGTCTTTTGACTATAAAA
ACATCACAATCGATCAACTTCAATTAAATAAAAGTCTGAA
GTTCAAAAACGTTCGTCGACATGCAAAGGCTGTTGCATCA
TGTATTCAATTTATTGCAAACTTATGAGGCATTTATGTTT
AC

hoxb8b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxb8b-001 882
hoxb8b-201 (1) 1089
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb8b-001 Contained in:
OTHER hoxb8b-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001795 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:Y14534 (1) 400bp
    CITATIONS (1)