header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2253
Transcript Name: smc3-201
Previous Name: smc3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012597 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012597|OTTDARG00000010869|ZDB-GENE-030131-3196 smc3|OTTDARP00000010815 cspg6-001 LG_none BX649294.7,BX649360.12 Danio rerio protein_coding KNOWN, 4680 bp
TTTTGACTGTTATGTCTTTTGCGTGAGGGGAGGGAAAATA
AAATTTGATACTACAGAAGAGTCAAAATTCAACAATTTTA
TCCGGTGTGCAGGATTTTTTTGTTATCACTAAAGCCCTTC
TTCTCTTTGAGGAGGAGGGTGTTTAATTCAGCTTTATTTA
ATTGGTTTCTGAGGAGTGTTTTGTGCATAAACCGCCATGT
ACATTAAACAGGTCATTATTCAAGGCTTTCGAAGCTACAG
AGATCAAACTGTGGTCGATCCCTTCAGCTCAAAACACAAT
GTCATCGTCGGCAGAAATGGATCAGGAAAGAGTAACTTCT
TTTATGCTATACAGTTTGTACTCAGCGATGAGTTCAGTCA
TCTTCGGCCAGAGCAGCGTTTGGCTCTGCTTCATGAAGGC
ACTGGTCCTCGAGTCATTTCAGCCTTCGTGGAAATCATAT
TCGACAACTCTGACAACAGACTTCCAATTGACAAAGAGGA
AGTGTCACTGCGCCGTGTCATTGGAGCCAAGAAAGACCAG
TACTTCTTGGACAAAAAGATGGTCACTAAAAACGACGTGA
TGAACCTTTTAGAGAGTGCTGGATTCTCCCGCAGTAACCC
TTACTACATTGTCAAGCAAGGAAAGATCAACCAGATGGCT
ACGGCGCCCGACTCTCAGCGTCTGAAGCTGCTCCGAGAAG
TGGCCGGAACCAGAGTCTATGATGAGCGCAAGGAGGAGAG
TATCTCGCTTATGAAGGAAACGGAGGGAAAGCGAGAGAAG
ATTAATGAGCTGCTAAAGTACATCGAGGAGCGTCTGCACA
CTCTAGAGGATGAGAAAGAGGAACTGGCGCAGTATCAGAA
ATGGGACAAAATGAGGAGAGCGCTGGAGTACACCATATAC
AACCAGGAGCTCAACGAGACCCGCGCCAAACTGGACGAGT
TGTCTTCTAAAAGGGAGACCTGTGGAGATAAATCTAGACA
ACTGCGGGATGCCCAACAAGACGCCAGGGACAAAGTGGAG
GAGACGGAGCGTGTGGTGCGGGAGCTGAAGTCTCGAATCT
CCGCCATGAAGGAGGAGAAGGAACAGCTGAGCGCAGAGCG
ACAGGAGCAGATCAAACAGAGGACCAAACTGGAGCTCAAA
GCCAAAGATCTGCAGGACGAGCTGGCAGGAAACAGCGAAC
AGAGGAAACGGCTGCTCAAAGAGCGACAGAAGCTTCTGGA
GAAGATTGAAGAGAAGCAGAAGGAGCTGCAGGAAACTGAA
CCCAAATTCAACACCGTGAAGGAAAAAGAGGAGCGAGGAA
TTGCCCGGCTTGCTCAGGCCACACAGGAGCGCACAGATCT
TTACGCCAAGCAGGGTCGAGGCAGTCAGTTCACCTCTAAA
GAAGAGCGAGACAAATGGATCAAGAAAGAGCTGAAATCTC
TGGATCAGGCCATCAATGACAAGAAACGGCAGATCGCCGC
CATCCACAAAGATCTGGAGGACACCGAGCAAAACAAAGAG
AGAAACCTGGAACAGTACAACAAACTGGACCAGGATCTGA
ACGAAGTGAAGACTCGAGTGGAAGAGCTGGACAAGAAGTA
CTACGAGGTGAAGAACCGAAAGGATGAGCTTCAGAGCGAG
AGAAATTACCTGTGGAGAGAGGAGAACGCAGAACAGCAGG
CGCTGGCAGCCAAACGAGAAGACCTGGAGAAGAAACAACA
GCTACTGCGAGCCGCTACCGGAAAGGCTATTTTGAACGGC
ATCGACAGCATTAATAAAGTCCTAGAGCATTTCCGGCGGA
AGGGCATCAACCAGCACGTCATCAACGGCTACCACGGCAT
CGTCATGAATAACTTTGAGTGCGAGCCCGCTTTCTACACC
TGTGTGGAGGTGACTGCAGGAACCAGGTTGTTTTACCACA
TTGTGGAGACAGATGAAGTGAGTACAAAAATCCTGATGGA
GTTTAATAAGATGAACTTGCCTGGTGAAGTCACCTTCCTG
CCCCTTAGCAAACTGGACGTCCGGGACACGGCTTACCCTG
AGACTAATGATGCAATCCCCATGATCAGCAAGCTCCGTTA
CAGTCAAAACTTTGACAAGGCCTTCAAACACGTGTTTGGG
AAGACTCTGATTTGCCGCAGTATGGAAGTGTCCACTCAGC
TGGCTCGAGCTTTCACCATGGATTGCATCACTCTGGAGGG
TGATCAGGTGAGTCACCGTGGAGCTCTGACTGGCGGTTAC
TACGACACTCGTAAGTCCCGTCTGGAGCTGCAGAAGGACA
TGAGGAAGGCCGAGGAGGAGCTCGGAGAACTGGAGGCCAA
ACTCAACGAGAACTTGCGTCGAAACATTGAAACTATCAAT
AATGAAATTGACCAGCTGATGAATCAGATGCAGCAGATCG
AGACCCAGCAGAGGAAGTTCAAGGCCTCCAGGGACAGTAT
TCTGTCTGAGATGAAGATGCTGAAGGAGAAGAGACAGCAG
TCGGAGAAGACTTTCATGCCCAAGCAACGTAGTCTTCAGA
GTCTGGAAGCCAGTCTGCACGCCATGGAGAGCACACGCGA
GTCCCTGAAGGCCGAGCTGGGGACGGATCTGCTTTCTCAG
CTCAGTTTAGAGGATCAGCGCAGGGTGGACGACCTCAATG
ATGAGATCCGACAGTTGCAGCAGGATAACAGACAGCTGCT
CAATGAAAGAATTAAACTGGAGGGAATCATGACCCGGGTG
GAGACGTACCTCAATGAAAACCTGCGCAAACGTCTTGATC
AAGTCGAGCAGGAATTAAATGAACTGAGAGAAACGGAAGG
AGGAACCGTCCTTACAGCGACAACATCAGAGTTGGATGGC
ATTAACAAACGCATAAAAGACACTATGGCTCGCTCTGAAG
ATTTGGACACCCTTATTGATAAGACAGAGGTGGAAATCAA
GGAGCACCAGAAGAGCATGGAGCGCTGGAAGAACATCGAG
AAGGAGCAGAACGAAGCCATCAATCACGACACCAAGGAGC
TGGAGAAGATGACCAACAGACAGGGCATGCTGTTAAAGAA
GAAAGAGGAGTGCATGAAGAAGATCCGTGAGCTGGGCTCC
CTGCCGCAGGAGGCCTTCGAGAAGTACCAGACGCTCACAC
TCAAGCAGTTGTTCAGAAAGCTGGAGCAGTGCAACACGGA
ACTGAAGAAGTACAGCCATGTGAATAAAAAAGCCTTGGAT
CAGTTCGTCAATTTCTCAGAGCAAAAAGAGAAGCTGATCA
AGAGGCAGGACGAGCTGGACAGAGGCTACAAATCCATCAT
GGAGCTCATGAACGTCTTGGAACTGCGCAAATACGAGGCC
ATCCAGCTCACCTTCAAACAGGTGTCAAAGAACTTCAGCG
AGGTGTTTCAGAAGCTGGTGCCCGGCGGTAAAGCCACTCT
GGTGATGAAGAAGGGTGACACTGAGGGTGGACAGTCTCAG
GACGAGGGTGAGGGCGGAGACAGCGAGAGGGCATCGTCTT
CTCAGAGCAGTGTGCCCAGTGTGGACCAGTTCACTGGAGT
GGGCATCAGGGTGTCATTCACGGGTAAACAGGGAGAGATG
AGGGAGATGCAGCAGCTTTCTGGAGGTCAGAAGTCTCTGG
TGGCTTTGGCTCTCATCTTTGCCATCCAGAAGTGCGATCC
TGCTCCATTCTACCTGTTTGATGAAATCGACCAGGCTCTG
GACGCTCAGCATAGAAAAGCAGTGTCAGACATGATCATGG
AGCTGGCCGGACACGCTCAGTTTATCACCACCACTTTCAG
ACCCGAGCTGCTAGAGTCGGCCGACAAGTTCTACGGCGTC
AAATTCAGAAACAAGGTGAGTCACATCGATGTGATCTCAG
CAGAGCAGGCAAAGGATTTTGTGGAGGACGACACCACTCA
CGGCTAAGAGAAAAACACACACCTCTGGCAGTCATTTTTC
TCATTTTTCCACCCCCATCTCAACTGGTGTGTTTCCTTTT
TAAAATCCCAGATGGGTCAAAAGCTGTTTGTTTGTTTGTT
TGTTTGTTTTTTATTCTGAGCAGGATTCGCTGAAAAATGG
TGGTTTTTACAGTTTTATATTTTCTCTCCTCTTATTGATT
TTCTTGTATTTCAAGGATAAAACACTGAAATGTTTGTTTG
TTTGTTTGTTGTCCCGAGGCCAATGCTTGAGACTTGCTTC
AGCTTGAGTTATTTAAAGATGAGAAAGTTAGGGAACCCAT
GTTATAAGCTGAGATGTTAAAGGGGTAGTTCACACAAAAA
CCTTAATGTGCTCATTGTTTACTCTTCCCCAAGTCATTCC
AGACATTGAGTTTCTTTCTTTTTGGTGAACAAAAAAAAAA
AGGATAATTTGAAGAATGTTGGAAACCTATAATTACTCAC
ATCCATAAAAGAAATACTATTGAAGTCGGAGGTTTTCAGG
ATTTTTAAAATATCTCTGTTCAACAGGAAAGCACATGGAG
GGTGAGTTGATGATTTTTAATTGTTGTGTGAACTATCTCT
TAAGTCTGTTCGTCACAGGTTCTCTCTTCTTTACTCCTCA
TCAACTAGCATGAGCTGTTCACTTTTTTTAAGCGATATTT
GTGAAAGCGGCTCGTTTTGTAGGATTTTTTTCCCCCCTGA
ATGAGCTTAAATGTTTTTATCAACGTTTGCTTCATTTGTT
CTTTGATCATTGTGATTTAGTCTTTTAATGTGTTTTCTGT
TACCCATACAAGAATAAAATAACCCTGATCTTTAACAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smc3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000012597 (1),  Ensembl_Trans:ENSDART00000019786 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC044408 (1) 4286 bp
GenBank:CK028148 (1) 1205 bp
GenBank:CN330666 (1) 860 bp
GenBank:CK236561 (1) 846 bp
GenBank:CK706446 (1) 806 bp
GenBank:CK028631 (1) 789 bp
GenBank:CK679716 (1) 789 bp
GenBank:CK679634 (1) 731 bp
GenBank:AI722904 (1) 704 bp
GenBank:BM182736 (1) 681 bp
GenBank:BM859704 (1) 650 bp
GenBank:CD283711 (1) 646 bp
GenBank:BM890381 (1) 645 bp
GenBank:AI877911 (1) 601 bp
GenBank:BQ617539 (1) 592 bp
GenBank:AW422566 (1) 569 bp
GenBank:BQ450801 (1) 566 bp
GenBank:BM156652 (1) 530 bp
GenBank:AL718775 (1) 525 bp
GenBank:BQ616669 (1) 503 bp
GenBank:BM529559 (1) 495 bp
GenBank:BM156922 (1) 475 bp
GenBank:AI793847 (1) 474 bp
GenBank:AI721639 (1) 472 bp
GenBank:AI397388 (1) 462 bp
GenBank:AI722427 (1) 439 bp
GenBank:AI522363 (1) 382 bp
GenBank:AA495021 (1) 377 bp
GenBank:AA495038 (1) 280 bp
CITATIONS (2)