ZFIN ID: ZDB-TSCRIPT-090929-22373
Transcript Name: si:dkey-150i13.2-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042678 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042678|OTTDARG00000030748|ZDB-GENE-090312-157 si:dkey-150i13.2|OTTDARP00000033892 DKEY-150I13.2-001 LG_none CR376802.12,BX546500.7 Danio rerio protein_coding NOVEL, 2609 bp
GAGCAGATGGTCAAAGAGCAGACAGCTCTGATGTAGTTGT
ATGTAGTTGATGTAGTGTACCTTTGTTGAAATTTTGTTAG
AATTGTAGAAATAATAATAATGGATACTGTGGAGTCAGAC
AGAAGAGTTTCTCCTCTGAAGAATTTTGTGGCAGGAGGGT
TTGGTGGCATATGTCTCTTACTTGCTGGACATCCGCTGGA
CACAATCAAGGTCCGTCTACAAACACAGGACTGCGCTGTC
TACAAAGGAACATTTGACTGCTTTCGAAAGACTGTGTCCA
AAGAGGGAATATTTGGCTTGTATAAAGGAATGGGTGCTCC
ACTAGCTGGTGTAACTCCAATGATGGCTTTGAATTTCTTT
GGCTTTGGACTGGGAAAGGAACTTCTGCAACGTGACCCAA
CTGTACCAGCAACGTACACACAGATCTACTTGGCTGGGAT
GCTGGCAGGGGTGTGCACCACTGTGATTGTGGCCCCAGGA
GAGAGAATCAAGTGTTTACTTCAGATCCTGCCCCTGGCTG
GTCGAATGAAGTATACTGGACCATTAGATTGTGCTGTCAG
ACTTTATAAACAACAGGGCATTTGCAGTGTCTACAAGGGA
ACTATTCTTACTTTAATCAGAGATGTGCCCTCAAATGGTG
TATACTTTCTAACATATGACTACTTAAAACACTATCTGAC
CCCTGATGGAGAATGTGTTCATCACCTCAGCACATCCAGA
GTTCTTCTTGCTGGTGGGATTGCTGGCATGATAAACTGGC
TAATTGCTCTGCCTGCAGATGTGCTGAAGTCAAACTACCA
ATCAGCCACAGACGGGCGTTACCAAGGTGTAAGACATGTG
TTAAGAACACTGTTAAAGGAGGAAGGAGCTCAAGGACTCT
ACAAAGGCTTTAGCGCAGTTATGTTACGAGCATTTCCTGC
TAATGCGGCTTGTTTTCTAGGTTTTGAGGTTGCTCTAAAG
TACTTAAACTACATTGCTCCAGACTGGTGATGTCACATTT
AGAATTGATGTGGGTTCTTATTTTAATACATTTACCCTCT
GTTATATATAGCATTTCTTCATTGAAGGGCAGGCAGGCAT
GGTGGCCCAGTAATGCACAACACAACAACATTTCAAAAAG
CATACATTAAGCTCACAACTCAGTGAACTTTTAGAAAGCA
AACATTGGCTGTTTCTCAATTCCAAGAATGCAAGTACTTC
CAGGTGTCGAGAACGAACTCGGGAGACCACGAGAACAGAG
AACACGTCCTGTGAGAAACATTACAACATTCATACAATGA
TTTATTGTTTTTCCCCTTTTCAAAATATATACTATTCATA
AAAACTTTATAAATATACGTTGCACAATATAAATAAAAAA
TATTTGAATACAAATTTCAGCAAATAACCACTGTCAATGT
GTTTATTATTTTATTAAGATGTTCATGGTAGTTTTCTTTC
ACCGTTTCATTTAGGGAAACCTAAATCAATAATATCTCTC
CTGAGATAAATAAGTTCTATCTCTGAACTTTAATAATAAA
TCTAAATAAATTGCTGCGCTTCCCACCTCCAGTCCCAATG
ACTTCTGGGACTTCTAGAGCGAGTTCGGTGTTCAAGTCTG
CATTGATGCATCCTCGATATCAAGAACGCATCTGGGAAAT
TTCACGCGTACTCGGTTCTTGCGGTCTTGAGTATTAGAAT
TAAACTTTGGCAGCTGATGATGACATTACACGAGAACACG
AGGACGCAAGCCCATTAAACTTACAACGCAATGAAAATGC
TCCCAACCACTAGGTGGCAGAGGAACACAGATTACTTCTG
GTTGAATGGAACAGCAATAATCTCTAGACACCACAAGAAA
TCTGTTACAATTTGTTGCTACCAATGAGCAAGAAGTGGGT
TTTACCTCAGGTCATGATCGTCTGCAACTTCTGTGTAATG
AGCGAATACCCATGAGATTAGGGTTACCACTTTTAATACA
AAAAAATAAGGGACGCATACTGCAGCAGGGGCCACATCCC
TAATCACATGCCCAATAGCATGTCAGTGTTGGTAAATCGC
AACTTAAAATATGTTTTCAGGAAAGTGTAAACACGTAGAC
ATTGAAATAAACTAGTCTTTAATTGACATCTGTGTGAACA
GATGCAGTCAGTATTTCTTTTTTACAACTCTCCAACACTG
ATAAAGCTGATGTTATGTTTAATAGTGTGGTACACCTGTG
TTAACTTAGTTGCTGTAACCTAGAGGAGAGAAAATACTAA
TGAACCTAATTTTAAAGGGTGGTATTGATAACAGATTTTG
GCTAAAATATTTGTCATTATTTGCAGTATCATCTAACAAA
AGCACATACATAAACTAGATACAAACAAGTGTGTTTCTTT
TGTTCTGTTGTCCTGTAGACACCTTTCTGCTGAGAGAACA
TCTGAAAGAATGTTGAAAACGAGTACTGAAACGAGTAAGA
GTAATGAAAGCTTAAAGTTTGCTTTCGGAAATTTTGCTGT
GTTGTGAGTTAATGATTGCTTTATAAAATGCCATTGTGCT
GTGCACTACTGGGCCCATGTAGACAGAAAGAGAAAAAACT
AATTGGACTCAGTTTTCCTTATTTCATTAAAAATCTACTC
GCAATTCTA

si:dkey-150i13.2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA si:dkey-150i13.2-001 2609
ncRNA si:dkey-150i13.2-002 (1) 719
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-150i13.2-001 Contained in:
OTHER si:dkey-150i13.2-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042678 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH492592 (1) 846bp
    GenBank:EH518921 (1) 685bp
    CITATIONS (1)