ZFIN ID: ZDB-TSCRIPT-090929-21893
Transcript Name: zbtb17-202
Previous Names: zbtb17-001, si:dkey-21o19.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042154 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042154|OTTDARG00000030438|ZDB-GENE-090313-240 zbtb17|OTTDARP00000033562 DKEY-21O19.10-001 LG_ CR925709.5 Danio rerio protein_coding NOVEL, 1795 bp
ACCCAGCGGCCTGCAAAGCTCACGAGAAAACACACAGTCC
TGTAAAGCCGTACTGTTGCTCCACATGTGGAAAGAGTTAC
AGACAGATCAGTCTGCTGAACCTGCACAGAAAGCGGCACA
CAGATGAAGCAAGATACAGCTGTGAGGACTGTGGAAAACT
CTTCACCACTTCTGGAAACCTGAAGCGCCATCAGCTGGTG
CACAGTGGAGAAAAACCTTACCAATGCGATCACTGCGACC
GGGCCTTTTCTGACCCCACCGCAAAGATGAGGCACCTAGA
GACCCATGACACTGACAAAGGGCACAAATGTCAACACTGT
GACAAGAAATTCAACCAGGTGGGTAACCTGAAAGCACATC
TAAAGATCCACATTGCGGATGGGCCACTGAAGTGTAAGGA
GTGTGGGAAACAGTTCACCACCTCAGGAAACTTAAAGAGA
CACCTGCGTGTGCACAGTGGTGAGAAGCCGTTCATCTGTA
TGCACTGCCAGAGAGCCTTCGCCGACCCCGGGGCCCTGCA
GAGACATGTTCGCATCCACACGGGTGAAAAGCCCTGTCTG
TGTCTGATTTGTGGAAAAGGCTTCACACAGGCCAGTTCAC
TCATCGCTCATGTTCGCCAGCACACCGGAGAGAAGCCATA
TGTGTGTGACCGCTGCGGCAAAAGGTTTGTCCAGTCCAGC
CAGCTAGCAAATCACATCCGTCACCATGACAACATCCGAC
CACACAAATGCCAAACCTGCAATAAAGCATTTGTCAACGT
GGGCGATCTGTCAAAGCATATCATCATCCACACAGGAGAG
AAGCCTTTCCTGTGTGATAAATGTGGTCGAGGATTCAACC
GTGTGGACAATCTGCGTTCGCATGTGAAGACGGTGCACCA
GGGGAAGGCGGGCATGAAGAGACTTGTTGTGGCAGAGGAT
GACGACGGGGAGGACAAGCTGCTGGCAGACTCGAACCCGG
ACTCTGAGCTCGACAGTAATGAAGTCAACATCGTCACAGT
TACTACAGATGATATTGTGACTTTGGCCACAGAGGCTCTG
GCTGCTACTACTGTAGCACAGCTCACAGTGGTACCGGTCG
CAGCTTCTGTATCTGCAGATGAAACCGAGGCACTAAAAGC
AGAGATCACCAAAGCTGTGGAGAAAGTACAAGAAGCAGAT
CCCAACACACAGATTCTGTATGCATGTGACTCGTGTGGAG
AGAAGTTTCTGGATGCCAGTTCTCTGGCTCAGCACGTGCG
CATTCACACCGCTCAGGCCCTGGTCATGTTTCAGGCAGAC
TCAGACTTCTACCAGCAGTACACCGGAGACGCCACATGGC
AAACCACCGAGCAGGTCATCCAGGGAGGAGAGCTTCTGTT
CAGGACACGCGACGAGGAGAGCGAGGAAGCCCAACCAGAG
TCTCAGATGGACGGGGCAGAGGTGGAGAGCGAGGATGGGG
CTGAAAAAGTGCACTCTGAAAGCCAACAGCAGTGAGGAGA
TTCAGGTCTGAATCCATAATAGATCCACATGGAATTGAAT
CTGTCACAAAGTGTAATATTTGTCATCAGAGGGATGGTTA
TTATCATTTATCATGCTGTAATAAAACGCATTCATATTTA
GAAAATATGAGCAAGATGAAATATAATATCCCAAATCAAA
AGAAATGTGTGTACAGCATATTGAAATTCTATTGTATAGT
GCTAATTATATAAAACAGGATCAGATAAATGTACTTAAAT
GAACAAAATGTAATTTATGCTGATCGTCAAAACTTTTAAC
ATACTGTCGTCACCCTATATATGTCTTCTGTGCAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zbtb17-202 Contained in:
OTHER zbtb17-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042154 (1)
  • Ensembl_Trans:ENSDART00000141552 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT586080 (1) 777bp
    GenBank:EB951682 (1) 668bp
    GenBank:EB914763 (1) 629bp
    CITATIONS (2)