header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21804
Transcript Name: lactbl1a-201
Previous Names: lactbl1a-001, si:dkey-68l7.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042053 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042053|OTTDARG00000030375|ZDB-GENE-030131-7625 lactbl1a|OTTDARP00000033486 DKEY-68L7.3-001 LG_ BX005235.9 Danio rerio protein_coding NOVEL, 2040 bp
GGGTTATATTGTAAAGATTAAAGCATGGCTGCTGAGTGGC
TGGTAAGCTCTGGTTATGCCTCTATGTTATCAGCATTAAT
GGAATTCCACTTTCAATGTTTTTTTTAATCGAGCCTCTGC
ATGGATAGGCAAATCAGCTGGGAGCAATGCGATGTGGCAG
GATCATACGGAACACTGATTTTGACTTAAAGGAGTAGCAA
AAGCCTGTGCCTGTCAGAAAAGAAGACTATTAGTCTGCAA
AAATGAAAGTGAAATGGACAAAGTTGGGAATGGTCTTCTT
TCTGCTTCTCTCCAGTGTAATGACAGGCTGTTTCATTTGG
CAGTACAGGCTCCCTAAGGCAAAACCAGTGGATGTAAAGG
CTGCGGAAGAAGTGAAAGATGAGATAATGTGCCCACGTTT
TCCAGAGCCTGTGCCACTGGTGCACCCAATTCCTGTCCTC
ATGGACGCACTGGATAAAGCGGATGTGCTTTTGAGGAACA
GCATTGATGCCACAAAGCTGCCCGCCATTTCTGCCATTGT
AATATTTAATGATTCTGTATTGTGGAATGGAAACTTTGGC
AGAAGGAATGGAAGTGACCCTACGTCTTCCGTTACAAATG
AGTACACAGTTTACAGAATTGCAAGCCTTTCCAAAATCTT
CCCCACCTTGATGCTGTATAAACTTTGGGAGGACGGAAAA
GTGGATTCCCTGGACGACCCGCTGGGGAAATATCTTAAGA
ACTTCACCATAAAAAACCCTCTGGGGAAGAGAAGAGATCA
TGACCCCAAGTCTGTCTCTGAAAGCCGGAGCAGTAAAGAA
GTTCACATCTCTTCAGTTACTCTGAGACGGATGGCCAGCC
AGCTGTCAGGTTTACCAAGGCGGCTCAGAGCGACTACACT
ACTCTGGAAAGGCAACACTCAAGCTGCAGTGGATTTATTA
CAAGATGATGTTCTCGTGGCCGACCCCGGAACCAAATGCC
ACTACAGCAACCTGGCCTTCTCGCTGCTTGCCCATGTGAT
GGCGGAGAAGGTGGCTGGCATGGATTATCAGCGATGGGTA
ACTGAGAATATCCTGCAACCATTGGGAATGGAGGACACTG
GGTTTGAAATCACTCCACAGATTAAGAACCGGATGGCAGT
AGGTGTCTACTCAAGCGGGCGTCCCGCGCCTCTTTATGAC
CTCGGCTGGTACAGACCTTCAGGGCAAATGTACTCAACAC
CAGCTGACATGGCCAAACTAGCGATGATGCTGCTTGGGGC
ATTTTACTGGCAGGTTCTCCAACCTGATACCCTCAAAACC
ATGTTGACTCCATTGTTTCGATGTGAGAACAGTTACTTTG
CCAATCAAACGGGAACACCTTGGGAGGTAAATGAACAGTT
GGGTTATGATGTTATACGCAAAGATGGAGATCTGGATGGA
TATTCAGCTTCGATTTCCCTTGTTCCTCGCTTGAAGCTCG
GATTGGTCATCCTAATGGCTGGAAGCAAACCTGTAGATGA
GGACCTTGTGGCCAAAACCTACAGCTATATCATTCCTGCC
ATGGAGAGTGCCTTCAGAGATACACCCCGTGTTCTCATTC
CTCCTCCAGACCCTACTCCCTATGTAGGGTATTTTACTTA
TAGTAATATTACATTCTATGAGATCAAAGCCAATGCAGAT
GGAGTGCTGTCTCTCGAGCAGTTCGGACCTCAAGTTGATG
ACATGGTTCCTGTGAAGTACAGGAGTTTGAAACTCACTTA
TCTACAGGACAGGGTCTTCAGGTTGGTATTTGAGAAGGAG
TATCCGTGTCAGCTGAAAGTCAACGCTGCCTCTGTGTCTC
TTGAGTCTCAGGACGGGCAACTATTTAACTTCTATATCTT
CAACAAAAAGGGGCTCTCATCTGGTTTTGATGTCCCAGGG
TTAAACACGTATAAAGTCATGCGGATATTCCGCAGGCCTA
TTTTTAGCAGTTGAAGAAAAGATTTTAATTTTTAGTCACT
TTTATTATTGCTTGGTGACATTTCATGAGCGAAATTCTGT
CATTTCAATTAAAAGCATTAATAAAGCCATGGCAATCTCA

lactbl1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA lactbl1a-201 2040
lactbl1a-202 (1) 1007
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lactbl1a-201 Contained in:
[BAC] DKEY-68L7 (1) (order this)

OTHER lactbl1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042053 (1)
  • Ensembl_Trans:ENSDART00000135690 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH594258 (1) 1010 bp
    GenBank:AW826673 (1) 499 bp
    GenBank:EB870522 (1) 428 bp
    GenBank:EE207183 (1) 404 bp
    CITATIONS (2)