header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2180
Transcript Name: scamp4-202
Previous Names: scamp4-001, zgc:114143-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012250 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012250|OTTDARG00000010613|ZDB-GENE-050913-40 scamp4|OTTDARP00000010539 CH211-129C21.2-001 LG_ BX005201.7 Danio rerio protein_coding NOVEL, 3885 bp
TCACCAGAAGGATCAACATTGTGAACTTTCTCTAAATTGA
AACATGACAGATCGAACAAATAACTTCCCTCCTTTGCCAA
AATTTCTTCGTATAAAGCCATGCTTTTACCAAAATTTTGA
TGAGGAAATTCCTCAACCCCACCGCCAGCTTGTGCGTCGC
GTCTACAATCTTTGGATGTTGTATTCCATGACATTATGTG
TGAACGTGGTGGGCTGCATAGCCTGGTGGGCCGGCGGTGG
TAATGCCACCAACTTTGGGTTTTCGCTGCTCTGGCTGCTG
ATTTTCAGTCCGTGCAGTTACACCTGCTGGTTCAGACCGC
TTTATAAAGCATTCCGGGCTGATAGTTCCTTCAACTTCAT
GGCGTTCTTCTTCATTTTCTTCCTGCAATGTGTGCTTGCC
TTTATCCAGAGTTTGGGAATATCCGGTTGGGGCGTTTGTG
GTTGGATTGCCACAGTGATATTCTTTGGCACAGATGTAGT
CGCGGCTATATTTATGCTCATCTGCACTCTGCTCTTCACT
GTAAACGCACTTCTCATGGCATTCGTTCTCATCAAGGTTC
ATCGACTGTATCGTGGCGGAGGGGGCAGTTTTCAGCGGGC
ACAGGAAGAATGGACCACCGGTGCATGGAAAAATCCAACT
GTAAGAGAAGCTGGATTCAATGCCATCTCTGAAACTGGCC
CCAGCCTGCCCCAGTACCCAGCCGCTGTGCCCAATTACCC
AGAAAGCGGGCCCTGGTGATACCACTTCTGATCTACAGAT
GGAGCCAAAGCAACACTGGTTGTCCTAATATTAAAGGCGC
AGTTTGCAGAGCGACGTTGCCCAACATTTGTGTGCCAAGA
AAACACTTTGGCCAGATCACAGACTTGTGTATATATTTTT
TTTAATATAGCAAAAAGATCTAATGCTAATTATTTCTCAT
AAACTTGATGCATTTTGATCTAGCAAACTCATTTAAAGTG
TGAATGATGATTGGAAATGTCAAACCACTGTTCTGGGCGC
AAATGTCACAGAGAAGGTAAAACGGCCAAGTCAAATAAGC
AAACTGCTCCTTTAAAACTGTGTCAACATATACTACCCTC
ATACTGACAGAAATGCTGGAACGGCAGTACACAAATCTGG
GAATACCAAACTGTTACATTGATCATTCATCTCAAATCAT
CTGAGCCTTGATTTATATTTGAGATATTTTAGGGTGTGTT
CACATTTGTTGTTCAGATTTCCAGGTTTTGTTTAGTCTAA
ACCAGAGGTGTCCAAACTCTGTTCTGTAGGGCCGGTGTCT
TGCATATAGTTCCAACCCCAACTAAACACACCAGCTAATC
AAGCACTTTTCAGGTATTCTAGAAACTTCGAGGCAGGTGT
GTTGAAGCAAGTTGGAGCTAAACCCTGCAGGACACCGGCC
CTCCAGCATGGAGTTTGGACAGCCCTGGTCTAAACCAAAA
CAAGTATCTTACATTTACGACCAATCCCAATTCTACCTCT
TAGCCTTTTCACTTCCCCCATAGCCCTATAAATGATGAAT
CGTTAGCACCACACTACAAACGAAGGGCTATGCAAATCTC
CAAATACACCAGCAACATGGCTGCAAAAGCAAGCAAGGAA
GCCCACAAATGTAAATGAGCATTAAGGGTTTTTTACTACA
AAAGCAGCATCTGATTTATTAGGTTAATAACATTGTTAAC
GTGGTACCTTCACGATCTTCAGAAAACGTTCTGCTTATGA
TAGTCCCTTATAATGCAAAATATTCTACATAATTTAAATT
CTAATAACGTTACCAGATGACTTGACAGAATAGGTCTGAA
GATGTTTTTTACAGCTCGTCTAGTATAATGTTAATGCTGT
TTCTTGTGGTTACATCATGAATAAGCACGGTGTAAATACA
ATTTCGTGCTTCTTACAACATGATCTGGCAGAAACAACAG
TGATGCCTGATGAAACCTGAAGGCTTATACACTTTCGACT
TGAAAATGAACAGCGTTGGTTTAAATATTCAGTCAGCAGT
GGCACGAATGTGGGTTAAGAGACTATAATCGGATATCAAG
ATCACCCAGCCCTATTCAACCTGCAAGGATGTTTTTGTTT
TATAATATTATAACTACTATAAAGTAGTTTTGGCCAAAGT
GCATCTATAATTTTCAGTTTCTGCCCAGAATTGTCATTTT
GGCTCATCCCTAATAATAACGAAGTTCCTTTAAGGCAAGT
AATTTCACTTGACGGCCATTTTGAAATGCCTCTCGAGCAG
TATGCTCGGGCATTCTGTCTGAATGGGGAATCATCAAATT
CTCCAAAACTGTTTGCCAAGCTTACTCTTACATACATGGA
ATCACCAATAAAATTAAACAACAACCGTCTCATAAGTTTC
ATTTCTAAACGTCCGAGTCAAACACAATAAGATTCTTTTT
CAAGTTGTCTGAGCTAATGCGCACTCGAAAGGAACAAGAT
CACAACACCAACCTCATTTAAGGCCATTCTACACATTATC
ACCTTCTGGATAATACTTTATCAGATCTCGCTGGTCTTCA
CAAGTAATTCACAACTTTGTCTTGATGGTGCATCGAAGTG
TACCTCGCGTTTGTTCATTCGTTTTCAAGTGCACTTGGTT
CATTTAAGTACAGATTTCAAGCTTTATGTGGATATATTTC
TGTGAAGCAAGTATTTGCTGCGATTCCACTGCATTTGTTG
ACCACCAAACTGTCGTAAAAGCACACGCCAGGTCTGAGCT
GCTCCCTCGGAGAAACGTCAGTCTATAGCAATTGATGATT
GGCTCCTGTACTAATACATGCTTCATTCGCCATATTGACT
GTTACACTTTTCCCCATTCAAAACTATACGAGTGACATGT
CTTGTGCATTCTAAAGTCTTTGTTAATAAGCAACAACAAC
GAGGAGGAGAAAAGCAGGTATTCTTGAGCATTCTGTCATT
TTAAAGGTTTTATCTAGTGCCATCATGTCCTGGTTTTGCT
TCTGTTTGATGTCTTTGTTAATAGTCAAGTTAATTTTGTT
TGGTGCACTCCCAAAATTCTGATGGCGGCGACTTATTCAA
GTAAACCACACTAACAAAGCCAAGTGTGAACACACCCATA
CTGACATTCCATTGACTTGTTTGCCAATTAAATCAATAAT
TGCACCTCCAATCACTAAATTTGGAGGATTATAGAGATAG
ATGGAAATCTCACTGCATCGCACATAATCACATTACCGTT
TTAGGGAAAGTGATTTCTAAGAGAGGAAAAAGCATGTCCA
AGTGTTCTTTTCTAAATCATGGCAGCTTTTCGATTTACCT
CTAGAAATTTGGTCTTGAATCACTTTCGCAATTACTATCA
ATTTTATTGTGCGACTTTTACAATTCACAAGCATGTCTTT
GTAAATGCACATGACACCCCCATTCCCCCTTTTTATACAC
TGCAGATGTTTTTATTTTATATCTATGACTGGAATGTTTC
CTTGCGATCACATGTTGTGCCTGCTCTCTTTTTTTGTTTT
AAGCTTATCACGTCTTCTCAGTGAAGACCGCCTTAATTCT
TCATGCATATTATTAAGCATGTTTGAACTAACTTTCCCTT
AAGTGCTAGCACGCTACATGCTCCTACTTTTTAACTGTTG
GTTTCTAATTATGTATTTGCATTTCTTTCGAATAATCATT
GTGCTTGGTATTGGAGCATTAATGTTTACACTTGAGGTTG
GCTGGAGGAAAGACACTCAGATTCAAAATGTGACTTGATT
TTTGATTCTTTTTTCTCAACATCCCTCCACACAGCCACAG
GAGGGTGATTTTACAGCATTCTACAACTGGCCTCGGTTAG
CCTGTGTATTTAATGATCTTGCATATGAAATGTGACTGAA
ACGACTCTCTAACTGAGTTCAGTTCAATAAAAACATTCCT
TTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
scamp4-202 Contained in:
OTHER scamp4-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000012250 (1)
  • Ensembl_Trans:ENSDART00000129975 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK029827 (1) 754bp
    CITATIONS (2)