header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21737
Transcript Name: si:dkey-92j12.5-201
Previous Name: si:dkey-92j12.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041966 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041966|OTTDARG00000030323|ZDB-GENE-090313-354 si:dkey-92j12.5|OTTDARP00000033433 DKEY-92J12.5-001 LG_ BX000461.4 Danio rerio protein_coding PUTATIVE, 1043 bp
TAGGGAACCCTCAAATGCACTGGTAGTCTTGTCATGCTAT
GCACACATATTATACACATACATGTATGCACACCACAGAA
GCACAACTTTTATCTCAGATGTCTGAACACAGTCAGCTTG
TATCTGTGTTTGTGGCAGGTGGGTGAAGTGGACGTCCCTC
TGTTCTCCTGTCTCAACACACACGATTCTGTGGACGGGAA
CGTCGATATCAGAACTGTCACTGTTCAGAAGCATGAGTGT
GACTCTGTGGAGCTGAGAGTGAGAGACACGCTGGGACATG
CAGGAATGTACATCTCTAAGCTGGACGCAAGCACGCTGGC
CGCACGCTCAGGACTTTTGCAGCTGGGTTCCAGAGTCATC
AGCATTAATGGGACACAAACAGAAAGGCTCTCAGTCGCTG
AGGCAAGCTTCCTTCTGAAAAACAGCAGCGGAGCAGTGAC
ACTGCAGGTAATGCCGAGTGGATGTGCAGATGGAGCCAGT
ATAAGTACAGATCGGTCATCTTTAATTCACTCCTCACCTG
GACTCTCAGAAAATTACACTACTCACAACCACCAGAGTTC
TCCTCAGTACCAGACCATCACTCTTGAACGTGGCTCCGCC
GGGCTTGGCTTCAGCATCGTAGGAGGATTTGGCAGTTCCC
ATGGTGACTTGCCCATCTATGTCAAGAACATATTTCCCAA
GGGAGCTGCGGTGGAGGACGGGCGTCTGCGGCGTGGAGAT
CAGCTGCTGACAGTCAATGGACAGAGTCTGGAGGGTGTCA
CTCATTCTGAGGCTGTCGAGATCCTTAGACAAACCAGCGG
GACAGTTATTCTACAAGTACTCTCAAAAAGACCACCATCA
TGCTGATAATGTCACACAATGACACGGTCCCATCGTGAAG
ATTCTCACAGAGCAGATGACGGATTGTTAAATGTGTTATG
GAGACTGCTTCTACCAGCTGTATTTCTCAAAAATGTCTCC
TGGAATGTGTAGTTTTTTAATATATCTATTTAATTGCAAG
GATATCTAGGAAAAAAATGTGGAAGTAAGCTGTGCAAAGT
GGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-92j12.5-201 Contained in:
[BAC] DKEY-170E5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000041966 (1),  Ensembl_Trans:ENSDART00000147857 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT587519 (1) 725 bp
CITATIONS (2)