Transcript

chrna9-201

ID
ZDB-TSCRIPT-090929-21736
Name
chrna9-201
Previous Names
  • chrna9-001
  • si:dkey-274k22.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041965 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041965|OTTDARG00000030322|ZDB-GENE-090312-63 chrna9|OTTDARP00000033432 DKEY-274K22.9-001 LG_ CR759875.6 Danio rerio protein_coding NOVEL, 2038 bp
CTGCTCAGGGTCGATTTGCTCAAAAACTGTTGAATGACCT
AATGGAGGGCTATTCTAATGCTTTACGGCCTGTGGAGGAC
ACAGACAAAGCCCTTAATGTCACTCTACAGATCACGCTTT
CACAGATTAAAGATATGGATGAAAGAAACCAGGTGCTGAC
TACATATCTGTGGGTTCGTCAGATCTGGCATGATGCTTAC
TTGAGCTGGGATAAAGAAGAATATGATGGACTTGAGGTCA
TCCGCATTCCCAGCAATCTTGTTTGGAGACCAGACATAGT
TTTATATAACAATGCAGATGAGGAGGACTCCTCAGGACCC
CCAGACACTAATGTGGTGTTGAGATATAATGGTGAGATCA
CATGGGACTCCCCTGCCATCACCAAGAGTTCTTGTAAGGT
GGACGTCTCCTATTTCCCCTTTGATAGTCAGGAATGCAAC
CTTACCTTTGGCTCCTGGACCTACAATGGCAACCAGGTGG
ACATTGCTATGGGCATGGAGAGTGGTGATCTTTCAGATTT
TGTGGATAACGTGGAATGGGAGTGTCATGGCATGCCAGCT
GTCAAGAATGTCATAATGTACGGTTGCTGCTCAGACCCGT
ACCCTGACATAACGTACACAGTCCTGCTCAAGCGGCGTTC
TTCTTTCTACATCTTCAACCTGCTTCTGCCGTGTTTCCTC
ATCTCTTTCTTGGCTCCACTGGGCTTCTACCTGCCGGCTG
ATTCTGGGGAGAAGGTCTCGTTGGGGGTGACGGTCCTGCT
GGCTCTGACTGTATTTCAGCTGATGGTAGCTGAAAGTATG
CCACCTTCAGAAAGTGTTCCATTAATTGGAAAATATTACA
TTGCAACAATGACCATGATAACAGCCTCTACATCTTTGAC
TATATTCATTATGAATATACACTTCTGTGGAGCAGAAGCT
AAACCGGTGCCCCACTGGGCCAAAGTTCTGATAATAGACT
ACATGTCAAAGATCTTCTTTGTGTATGAGGTAGGAGAGAA
CTGCACAACACCTGAAAGTGATCGAGGCCCATTTTTCTCT
GAAGATCCACTGGCTAGCCTGGAGAGAGATGGGTATTTTG
ACAAAGGGTTTTATGAAGACTGTCACCTTGATGAGAGAAT
CCGCAGTCAGTTTAATGGGTACAGTCACAGAGACCACCGA
CATGGGAATGGGTACCATCACAAAAACAGCAGCTATCGGC
AACATAGGAATGAGCAGCAAAGAAGAACCCGATCGTCATC
AAATTCCCCTGTTCGACAGAGTTCCCATCATCCAAAATAT
ACACACTTCATCGGTCGAGATGGAAGCGAAAAGCTCCCAC
TAACAAGTCAGGAAAAACTCAAAGACAGTGAAATCTCCAT
TCCAGAAAAAATTAACGGATACACATATGATCAGGGCAAT
GGGTATCTCAATGGAGTCGGCTACCTTCACGATAATGGCT
ACAGCAAAACCTTTGGAGCAGATAGCTACAATAAGACAAC
TACTGGCACAGGGTGTGTCTGTGGAAAACATCAGAAATTG
GTGCGAAACATTGAGTACATAGCTAACTGTTTCAGAGAGC
AGAGGGGACACCAGGCCAAAGGGGCCGAGTGGAAGAAGGT
TGCCAAGGTGATGGACAGGTTCTTCATGTGGGTGTTTTTC
ATCATGGTCTTCCTCATGAGTATTCTTGTCTTGGCCAAGG
CAACCTAGGAAAGTTTACAACTTGATGCAATTGGTAAATT
ACATAATAAGTAAATCTATGTGTCAAAAGACTGTAATTCT
GTTCTGCAATCCTGTATTTGTTGGCAAATGCATTCAGATT
AAAATGTGAATTACAGTTACAGCATGTGTTTTAGTTGTTT
GAATGTCTCCCTTTCTTCATTGCTGTCTTTGTTTTTTCCG
CTCCTTTTTTTGTAGTTGGTAAAAGTTAAAGAAATGGCAT
TAATATTTCAGGTGTAGAAGTGTTCCCACAAGTGTACATA
GAGTAACACAATCTTTGTCCAGCATGGACACACATTAATA
ATGCACAATTAACCCCGCACATGCGTATGGGCAGACAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations