header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21505
Transcript Name: si:dkey-7a20.9-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041454 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041454|OTTDARG00000030068|ZDB-GENE-090313-340 si:dkey-7a20.9|no_translation DKEY-7A20.9-001 LG_ BX294379.5 Danio rerio processed_transcript PUTATIVE, 876 bp
CTTGAAGCTTGGCGTAATTGCAATAATAGAGGCTTCAGTG
ACACACTGATAGGAGTCCGGCTTTCTACAGGAATATCCTC
CCCATTGGCTCGACGTACACGTTAAAAGGGAATTGCACTT
TCCCAGGTTATTCCAAGCCTGAAGAAAGGAATGTAGAGCA
CACGGCATGACACTGAGCTGTGACAGACTCAAGTGACTGT
AAGTACACCACTGATTTAACCTTATTATTGCCTATAAAAG
AAATATAAGAAATGTGAATTTGTAGTGCATGAAATGTATA
GAATAGCCTAAAAATGTCTATATTCTCATGAAGTACCTGA
CAAAAGAGAAAAAAAAAAGGTGAAAGGCATACAGACAGAG
CAAACAACATAAGTAAATATTATAATGTGGGAGGCTACAA
GCTTTTGTCCACGAACACTTTTCATTTTTTTGTTCTCCCA
GAAGTCCTCTTTTCATAACCTGTAATTTTAGCCTTATAGA
CAGCAGATGCTTCACTGTCCTCTCGCTTGTGTGACTCCAA
AAGTTTATTGTCAGTGTGGGCTCACCTGGTACAAAAGCAT
ACGAGCACATGCTGAATGGAACAGAAACCTGGGGGGAGGG
TTTACAAAAACAACTAACATCAGAAATAGAACATGATAAA
TATTGCAAGTTAGTCATGCCTGAAATGATTGTTATTAATA
GCCCACTCATTTTGCACTTTGCACACGAGTCATGTCAATT
ATTTCTTACACTCGCTACGTAAGAGTCATTTCAAAGAGGA
TTTAGAACAAAAGCGTACTTTGTTGTTTAGCTTACTCATT
TAGTTCTTTAAAAATGCATGTCTCGGCTGATTTGAATCTA
CTCGTGGGTTCTGTTTGAATATTCAAATAAATTTAG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-7a20.9-001 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER si:dkey-7a20.9-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041454 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO930954 (1) 851 bp
    CITATIONS (1)