ZFIN ID: ZDB-TSCRIPT-090929-21458
Transcript Name: phox2ba-201
Previous Names: phox2ba-001, si:ch211-157h5.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041406 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041406|OTTDARG00000030036|ZDB-GENE-090313-51 phox2ba|OTTDARP00000033074 CH211-157H5.5-001 LG_ BX323984.7 Danio rerio protein_coding KNOWN, 872 bp
TAGCTAATAAAAGCAACTGAGCTCCAACATAAAAACTGGT
CGGAGATCGGCACCACAGAGACTTCGCGAGTTTATGATGG
AGTACAGCTATCTGACGTCTCCTGCGTATGAGTCCGGGAT
GGAAACCGGCAGATCCTCGAGCCGTTCGGCGGACTTCAGC
TCCTGCACTCCTTCACTTTCCAATACAACAGGTGCAATTT
AGGAAACGCCAGCTGCCATTTCCTCTCGCCCGGATCTCAC
CAAACTTCCCACTACATAACAGTGCATTCTAATCTTATGG
CTTATGAACGAGGCGTCCAGGAGCGGCGCAAACAAAGGCG
CGTGCGCACCATCTTCACCAGCGCGCAGCTGAAAGCGCTC
GAGCGCGCCTTCGCACACACTCAATATCCGGACATCTACA
CGAGAGAGGAGCTCGTGCAGGAGATCCAGCTCACTGAAGC
CCGAGTTCAGGTCTGGTTTCAGAACAGACGTGCTAAATTC
CGCAAACAGGAGCGCGCAGCCTCATGGAATGAGTCTTCCT
CAAAAACACACAGTTCACCATCTCATGACAGCTCAGAAAC
AGCGAGCGCCACTGACCCAGACAGCACACAGCCCTCTCTT
CCCCTCATTGGGGACCAGAAGCAGGACAGCAGAGACAGAC
CACCTCCAGAGGAGCTGCCTCTGTTGTTAGGCTTAACTTC
TCTTGAAGCACAGAGACAGCGTGGTCATCAAATTCCCTGT
GTTGATTCTGTGTGCCTGTGTTGAACACTGAAGACATGAT
GTGCCATTTAAAACACTGAATACATTAGTTAGTGTCAGTT
TCTAACTTTTATTTTTGTTTTATCTTAACAAGTCTCTGAG
GGATTTAATATAGTAATAAATATATATGGCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
phox2ba-201 Contained in:
[BAC] CH211-157H5 (1)

Genome Resources: Vega_Trans:OTTDART00000041406 (1),  Ensembl_Trans:ENSDART00000141795 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EV555521 (1) 717 nt
GenBank:EX158895 (1) 700 nt
GenBank:AL924550 (1) 511 nt
CITATIONS (2)