header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21295
Transcript Name: mxa-201
Previous Name: mxa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041228 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041228|OTTDARG00000029939|ZDB-GENE-030721-5 mxa|OTTDARP00000032941 mxa-001 LG_ CT998565.24 Danio rerio protein_coding KNOWN, 2646 bp
CTGAAACTTTGTTGTGATAAGGATTTGTCTTTGGACATTA
TTAAGGATGGAGAAGTTGAGTTACACGTTCAGTCAGCAAT
ATGAGGAGAAAATTCGCCCTTGTATCGACACTATCGATAA
TTTACGGTCTCTGGGAGTCGAAAAGGACCTCGCGTTGCCT
GCCATCGCCGTCATAGGAGACCAAAGCTCGGGAAAGAGTT
CGGTTCTGGAGGCGCTGTCAGGAGTTCCGTTACCCAGGGG
CAGTGGGATTGTTACACGGTGCCCTCTCGAGCTCAAGATG
ATAAGAACTAAAGACCAAGATAAGTGGCATGGGAGAATCA
GTTACAAAACCTATGAGGAGGACTTCGATGACCCAGCGGA
AGTGGAGAAAAAGATCCGCCAAGCCCAAGATGAGATGGCT
GGAGCAGGTGTTGGTATCAGTGAAGAACTCATCAGTCTGC
AGATCACCTCTGCCAATGTTCCTGACCTCACTCTCATTGA
CCTCCCTGGCATTGCACGAGTGGCCGTCAAGGGTCAACCT
GAGAACATTGGAGATCAGATTAAAAGACTAATCAGGAAGT
TTGTTACAAGGCAAGAGACAATCAACCTGGTCGTGGTGCC
ATGCAATGTTGACATCGCCACCACAGAAGCATTGCAGATG
GCTCAGGCAGAGGATCCTGATGGCGAAAGGACTTTAGGCA
TCTTAACAAAGCCAGACCTGGTGGACAAGGGCACTGAAGG
GACAGTTGTAGACATTGTCCACAATGAGGTCATTCACCTC
ACTAAAGGCTACATGATTGTAAGGTGCAGAGGGCAAAAAG
AGATTATGGATCAGGTCACTCTAAATGAGGCTACAGAAAC
AGAGAGTGCCTTCTTCAAAGACCATCCTCATTTCAGCAAA
CTCTATGAAGAGGGTTTTGCTACTATTCCCAAGTTGGCAG
AGAAACTAACAATTGAATTGGTTCATCACATTCAGAAATC
TCTACCTCGCCTAGAAGAGCAAATAGAGACAAAGCTTGCT
GAAACACAGAAGGAACTAGAGGCATATGGCAATGGGCCTC
CATCAGAACCAGCAGCAAGACTCAGCTTTTTCATTGACAA
AGTTACAGCTTTCAATCAAGATATGCTGAACCTGACGACT
GGGGAGGATGTTAAATGTACTACAGATCTACTGCTTTTCC
CAGAACTTCGGCAAGAATTTGCAAAATGGAGTCACATCTT
GGATCGTTCAGGGGATTCATTCAACAAAAAGATTGAGAAA
GAAGTTGATAACTACGAAGTCAAGTACCGGGGAAGAGAGC
TACCAGGATTCATCAACTACAAGACCTTTGAGGGGCTTGT
CAGGGACCAGATCAAGCTGTTGGAGGAACCTGCGTTAAAG
ACACTGAAGACCGTCTCTGATGTGGTTAGAAAGAAGTTCA
TCCAACTGGCCCAGTGCAGTTTCATTGGATTCCCTAATCT
TCTGAAAATAGCAAAGACTAAGATTGAAGGCATTAAGCTA
AACAAAGAATCCCTGGCAGAATCTATGCTGAAAACTCAAT
TCAAGATGGAGCTCATCGTTTACAGCCAAGATGGCACATA
CAGCCAGAGTCTAAAGCATGCAAAGGATAAATTGGAGGAG
ATGGAAAAAGAAAGGCCACAACCGAAAATAAAACTGCCCT
TACTTTCGAGTTTCGACCTTGGCACAGACAATCATGCCAC
CTTGCGTGAGATGAGGTTGCACCTTAAATCCTACTACACA
ATTGCAAGCAAGCGTCTAGCTGACCAGATCCCAATGGTGA
TCCGCTACATGCTGCTGCAGGAAGCTGCTTTGGAGCTGCA
AAGGAACATGTTACAGCTGCTGCAAGATAAAGACGGTGTA
GACAACCTGCTTAAAGAGGACTGTGACATTGGCCAAAAGC
GAGAAAACTTACTGAGCCGCCAGAAACGTTTAATGAAGGC
ACGCAGCCTCTTGGTCACCTTTTAGAAGTTACTTTCATAG
ATTACTGCAACATTTTAATGCAATGAAATCGTATGCTGGT
ACTGAAGAAAATTATCAGCATTGACAGCAAAGAAGTAAAC
ATTCATGCTGTTTTTTTTTTTAAAGAAATATTCCTTTGAG
GAAACATGGTTTTTCAAAGCTACCTTTGTTATTTGAAGTG
CGTCTTGACCAGTGTCAGATGCTGTATATGACTTTTGGGA
CATGGTATTCTTATTTAAGTACAAATTGATGAAGTGTCAG
AACATTCAGTAAATTCATGTCATTTCAGTACTCTAAAAAA
ATATGACAATTTAATGTTTATATGTTACAACCAATGTTTC
GAAAATTGATAAACTATTTAGTGCTTTGTACCAGAAATGC
TGCAACAGATATTTTTTTAAATACCGTTTTCGAGGTATAC
CATGGTTTGGAAAAGTCATGGTTTTAAAACCGTCAACATT
TCCTGTTATACCTTTCCTAAGGTATGTGTAAGATTTTTTT
ATTTACTTTTTTTTAGGACAACAGTATGTCCAGCAAAAAA
ATATATCCAAAAATACCATTTTAAATTTTAAAGAAATCTG
TGTTTTTGGAACTAATGAAGACAGCAGAAGTCAATAATTC
ATTTGGATTATTTAGCTGGACATATTTACTGAATTTAGAT
ATTAATATTTACAAAATATTTTAAATGTTTTACAAAATAT
TTTATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mxa-201 Contained in:

OTHER mxa-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041228 (1)
  • Ensembl_Trans:ENSDART00000103588 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC117638 (1) 2680bp
    GenBank:AF533769 (1) 1941bp
    GenBank:AJ544823 (1) 1941bp
    GenBank:CK025875 (1) 841bp
    GenBank:AW202878 (1) 564bp
    CITATIONS (2)