ZFIN ID: ZDB-TSCRIPT-090929-21194
Transcript Name: exosc1-201
Previous Name: exosc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041114 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041114|OTTDARG00000029867|ZDB-GENE-080926-3 exosc1|OTTDARP00000032845 exosc1-001 LG_ BX119918.18 Danio rerio protein_coding NOVEL, 612 bp
GCTTCTTGAAAACATGTCGCCCATGAAGCTGTGTGTTCCA
GGCGAAAGGCTTTGCAGCACAGAGGACTGTATTCCTGGTA
CAGGCACGTATCTGCGGCACGGCTACATCTTCGCTTCACT
AGCAGGATACGTGCTGAGGAAGAATGAGGGAGAGGAGTTG
CCGGTGATTTCAGTTGTTAGAGAGACAGAAGCGCAACTTT
TGCCTGACGTCGGTGCGATCGTCACCTGTAAGGTGACGAG
TATCAACCCAAGGTTTGCTAAAGTGCACATCTTATATGTG
GGTTCGACACCGCTAAAGGACAGGTTCAGAGGCACAATCA
GAAGAGAAGATGTGAGAGCGACAGAGAAGGATAAGGTGGA
GACGTACAAAAGCTTCAGGCCCGGCGACATTGTCCTTGCA
AAAGTGATCTCTTTGGGTGACGTGCAGTCGAATTACCTGC
TGACCACAGCGGAGAACGAGCTGGGGGTCGTCGTGGCTCA
CAGCGAGGCCGGCGCGCAGATGGTGCCCGTCAGCTGGTGT
GAGATGCAGTGTCCTCGCACACACTCCAAAGAGTTTCGCA
AAGTTGCACGGGTACAGCCGGAGTACCTGCAGGCCTGACC
ACGCCCCTGACC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
exosc1-201 Contained in:
OTHER exosc1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041114 (1)
  • Ensembl_Trans:ENSDART00000083633 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BQ284256 (1) 601bp
    GenBank:BE201234 (1) 563bp
    GenBank:EB832982 (1) 296bp
    GenBank:EB832461 (1) 295bp
    CITATIONS (2)