ZFIN ID: ZDB-TSCRIPT-090929-21072
Transcript Name: atp1a1a.4-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040980 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040980|OTTDARG00000029783|ZDB-GENE-001212-4 atp1a1a.4|no_translation atp1a1a.4-003 LG_ CU185242.13 Danio rerio protein_coding KNOWN, 664 bp
GGATGGATGGATGGATGGATAGACAGACGGATAGACAGAC
GGATAGATGGATACATTGACAAGCAGATGGATGGATGGAT
AGATGGATACATAAACAAAAGGACAGACGGATGGACAGAC
GGATGGACAGACAGACAGACAGATAGATAGATAGATAGAT
AGATAGATAGATAGATAGATAGATAGATAGATAGATAGAT
AGATAGATAGATAGATAGATGTATAGATAGATAGATAGAT
AGATAGATGTATAGATAGATAGATAGATAGATAGATAGAT
AGATAGATAGATAGATAGATAGATAGATAGATAGATAGAT
AGATAGATAGATAGATAGATAGATAGATTTGGCAAAAGTC
TTAGCCCCGCAAAGCTGGTGGTGGCTTGAGATATTTGCAC
AGTGCTATAATTAAACTGTATAATTTAAGGATTATTTTAA
GGAGCACATCCTAATGTCCAACATTATTCTTTCTTAGAAA
CAAAATCCTCATCTTCGGCCTGTTTGAAGAAACTGCTCTT
GCAGCATTTCTGTCCTACTGCCCAGGCATGGACGTAGCTT
TGAGGATGTATCCGCTCAAACCGTGCTGGTGGTTCTGCGC
CTTCCCATATTCACTTCTCATCTTCGTCTATGATGAAGCT
AGAAGATATATCCTTAGGCGGAGC

atp1a1a.4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA atp1a1a.4-001 (1) 3246
ncRNA atp1a1a.4-002 (1) 887
atp1a1a.4-003 664
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp1a1a.4-003 Contained in:
OTHER atp1a1a.4-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040980 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB979450 (1) 675bp
    CITATIONS (1)