header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2105
Transcript Name: shc2-201
Previous Names: shc2-001, si:dkey-94n12.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011906 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011906|OTTDARG00000010362|ZDB-GENE-050208-666 shc2|OTTDARP00000010295 shc2-001 LG_ BX470234.8 Danio rerio protein_coding NOVEL, 1749 bp
GTGGTTTGAGTGGTTTCTCTCCCCCTTCGGGCTCAAACTT
CACATCTCATGACTCTAATGTGCTTCTACTTCTTTCTCTG
CATTCAAAAACATAACTGTGCATGTATTTTGTAGGGCTGG
AGCTGCAACCTAAAGCAGAGGGGAGTAGATTCGGCCTCCA
GGAGACAGAGGGCCAGTCAGAGAGAGTCCAGCGCAGGGGC
CGCCGAGGGGAGTCCAGGGGGCTCTGGGAGCTTCAGGACC
GGGATGAACCGGAGGACCAGGGTGGAGGGAATATGGCTCG
GGGATAACTTCACCCAGAAGGGCAGCTTCATCAACAAGCC
GTCTCAAGGGTGGTTGCACCCAGACAAAAAGATCAGCAGC
ACAGGGGCTTCCTACATCGTCAGGTACATGGGCTGCATTG
AGGTCCTCAAATCCATGAGATCGTTGGACTTCAGCACCAG
GACGCAAGTCACAAGGGAAGCCATCAACAGGTTGTGTGAA
TCTGTACCTGGAGGAAAAACTGCCTGGAAGAAGAAAACAA
CAAACAAAACCCTTCAGTCCATCATGGGCAAAAGTAACCT
GCGCTTTGCTGGAATGAGCATCGGCGTCAACATCTCCATT
GATGGCTTGAGTCTCCTCGTCCCTACAACACGGCAGGTTA
TTGCCCATCATCCCATGCAGTCCATATCTTTCGCCTCAGG
TGGAGATTCGGATACACCTGATTACGTCGCCTATGTAGCC
AAAGACCCCGTCAACCAAAGAGCTTGTCACATTTTGGAGT
GCTGCGACGGTCTTGCCCAGAATGTGATCAGCACCATTGG
CCAGGCCTTCGAACTGCAGTTCAAACAGTACCTACACAGT
CCACCCAAAGCCATTCCTGCCATGGATAGTCATGCTGAAT
ATCCTAATATATTGTCTAGAAATATAAGAACAGAAGAGTC
AGCATGGGGTGAAGACGAGGAGTCATCCGAGCACGATTAC
TACAACAGCATCCCTGGAAAGGAGCCTCCTGTTGGGGGAG
TGGTAGACTCGAGGCTCAGGCCTCCTGCGGGCCTACTGGG
CCACGTTCACACACACCCACAGAGCAAAACATCACAGATG
GGGTCACCGGCTAAAAGAGACGCAAACAGCCTTCCTGCCA
CCCACTTGTGTTATGAAGTGCACTGGGACACAGAGAATAA
CAGAAGCTCAAGTTTGACTTCTGATGGTTACTTGCGAGCA
GATGGTCATCCTCCAGGCAGTCGTGATTACGAGGAGCATC
TGTACGTAAACACTCAAAATCTGGACAACCTGGAGGCCTC
AGTGGTTGGGCGCAGACCTGAGAGCCCCAAGAAGGACATT
TTTGACATGAGGCCATTTGAAGATGCCCTGCGCCTCCATG
AAGCTAGTGGGGTTTGTGTGCTGGAGGACAAATGGCCGAG
TCCCCCACGTCGCAGAGCCCCTGTGGCCCCTACAGAAGAC
CAGCTAAGACGAGAGATGTGGTACCACGGCCGAATGAGCC
GCAGGGATGCTGAGAATCTGCTGGGCCGCGATGGGGATTT
CCTGGTACGGGACAGCGCTACTAACCCAGGCCAGTACGTG
CTGACGGGGATGCAGTGCGGCCTTCCTAAACATCTGCTGC
TGGTGGATCCTGAAGGAGTGGTCCGAACTAAAGACATGCT
TTTCGAGAGCATCAGTCACCTGATCAACTACCATCTGACA
AACAAGCTGCCGATTGTAGCGGCGGAGAGCGAACTACACC
TCCAGCAGGTCGTCTGCCGAAAAATCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
shc2-201 Contained in:
OTHER shc2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000011906 (1)
  • Ensembl_Trans:ENSDART00000132605 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK029932 (1) 733bp
    CITATIONS (2)