header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2101
Transcript Name: bsg-203
Previous Name: bsg-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011890 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011890|OTTDARG00000010351|ZDB-GENE-030131-9638 bsg|OTTDARP00000010279 bsg-002 LG_ BX664631.6 Danio rerio protein_coding KNOWN, 1714 bp
GAGTGAGCTCCGAGTCCGAACAAATAGAGGACGACTAGGT
TCCTCTGAAGGCTTTCTCCATTTTCTTTTTTCATCTCGAA
CAGGCCACTATTGGGTCAAGAATGGAAAGAAAATCGAAGA
ATCGTATTCGACAAATACAGACTCCTATGCTGAACACTTA
TTTTTGCATCTTACAGTGTTTTCTTTCTATGGCAGCATTG
AAAAAGCTGATTATCATCATTCCGGAATATATACCTGTGT
CTTCCTAACAGAACCTCAGGCCAATGCCACAATTGAAGTT
AAAGCTTTGCCGCACATAAAAGCTTCCAAAAGCTCAGAGA
ACGCTAATGAGAAAGACAAGGCTGTGCTGAGCTGTGGAAG
TCAAGGATACCCATCCCCTACTGACTGGAGCTGGTTCAAG
CTTCCTGATGCAGGAGAACGGACCCCCATCTTTAATGGCA
CTGATGATAAGTATGAGATCAAGAGCACCCCCAACAAGAC
CACACTGTATGTCAAAGACCTGGACATCAACGAGGACATG
GGCTTCTACCAGTGTCAAGGCACCAGTGAGGTTGGCACTG
GTACAGACGACATCCAGCTGCGTGTGCGGAGTCAGCTGGC
CGCTCTCTGGCCTTTCCTCGGGATCGTGGCTGAGGTCATC
ATCCTCATCACCATCATCTTCGTCTACGAGAAGAGAAGAA
AGCCTGATGAGATCAATGACGATGATGACTCAGGATCTGC
TCCCCTGAAGAGCAACTCCGCTACAAACCACAAAGACAAA
AATGTCCGGCAAAGAAACTCCAACTGAGGAAGGAGAAAGG
GTGTTTTCATGACTGCTGTTGAAGATATAAAGATCGTTGA
GTTTGAGTAGCACAATATAGTGCGCCCGGCAACTTCACCC
TCTGCTTGAGTGTAAATGTCTTGATGATGATAATAACTGG
TCTCCTTTTACTTTTATTCCTATCCATACTGTGCTGCAAG
CAGACCTTTTAAACGTGGGTTTAGGGAGGGTGGGGAGGGA
AGTACTGCATGATTGTATTGCTGTAGAAGTGTGTGTTTAG
TGGAAATCTCTTAATGTGGGAATAAACTGTTTCTCTTTAT
TTGATTTTTATTTTTGTCTTCCTGGCTTTTTCACTGTTCT
TCAAGTGTTCACAAATACAACAGTTCTGATTCTTTGGCAG
CAGTCAAAGCTTAGCTTCCTTGTTATTTTTCTGTACGCCT
TAATGTTTAGCCACTTTATTGTACATGCTGTTTTTAATAA
CATACAAATAATTTAAGCTAACTTTTATGTGCAGTACAGC
GTATTAAAGTGCTCTATTCCACGTGGATGGTCAAATGCCA
CTGTTTTTTTGTCTAGCTAACAGTTTGCCATTGAATAATA
ATAAAACAAGCATATTTTCAGGCTTCCTGTGTTAACCTTT
AGGACCAAGTGTTAGTACGCTGTGCCATTTTGCTCCTTGC
GTAATCAGTTACAAGTTCTTTTGCAGAATCTAACATGGAG
GACAATGACATGGTTGTGTGTGGAATTTTAGTGAATGCTT
GTTGCTTAAATGATTCTCCTATAGACAGTCATACTTTTGC
ATTGTGAAGTATAGTGTCTGGATGTGTGCCATTTGCAAGT
TAAGAGATAATTGTAAGACCTTGTTTAAATTATTTTTGCC
TTAGCGTCATAGGACATCTAATACACTGTCGACATGTACT
GACTTGCACAATCTTAAATAAACTATTTGATTTT

bsg TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA bsg-201 (1) 2288
bsg-202 (1) 1937
bsg-203 1714
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bsg-203 Contained in:

OTHER bsg-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000011890 (1)
  • Ensembl_Trans:ENSDART00000131131 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK361336 (1) 753bp
    CITATIONS (2)