ZFIN ID: ZDB-TSCRIPT-090929-20884
Transcript Name: dusp13a-201
Previous Names: dusp13a-001, zgc:172281-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040779 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040779|OTTDARG00000029672|ZDB-GENE-080204-69 dusp13a|OTTDARP00000032590 DKEY-24F15.1-001 LG_none AL929005.7,AL929334.12 Danio rerio protein_coding NOVEL, 1136 bp
GCAATCTGAGAACGAGAGGAAGAAAAGGGCCACCGGCTGC
AAAATGATGTCTCTCAAGGAGCTGTGTGCCTATGAAACCC
CATCCGTTGCTGAACTGCAGAACTTCCTGTTGGCTGACAG
ACGCCCCACTGGACATGTCAACCACGTGTGGCCTAATGTG
TACATTGGCAATGAGGTTGCGGCGCGAGACAAGCCAATGC
TGTATAATATGGGGATCACACACATTGTAAATGCTGCCAG
TGGACCGCCTCATGTCAACACTGGACCCCGCTTTTACAGA
GACATGAATATAGATTACTACGGAGTGGAAGCTGATGATT
CCTTTGACTTTGCCATAAGTGGGTTTTTCTATGCAACAGC
AAGGTTCATAAGAGCTGCACTGTCGAAAAATGGACGGGTG
TTTGTCCACTGTCTGATGGGAGTGAGCCGCTCTGCCACTC
TGGTGTTGGCCTTCCTCATGATCTGTGAGGATCTTACTCT
AATGGAGGCCATTAAAGCTGTACGGCAACACAGGGACATC
TGCCCTAACCCTGGCTTTCTTAACCAGCTCCGACATCTTG
ACATGAGACTCGTCCGAGAGAGGAAGAAAAAACTGGAAGC
TTACAAATTGTAACTGAAAACTTGGTAACAATGTGATGAA
TCCCATTTCAAGAGCACGTCCCTAAAGAGCCTTCTCCCTC
ATGGTTTTATCCCTGTTCCACTGGGCCAGACGTTATTTGC
TAATATTTATTGTGTCGCAAGGGCAAAATGGATATTAGGA
AGCTAAACTGAATGGTTTCCCCTTAAATAGTAAATAACTT
TTAAAGGGCAGCTGGGTCGCAAAATAAATGGCAGGTTTTT
AAATTTCTTCCAGATGAGACATACTTTGAACTTGTCTTAA
AATGAGCCAGCAAGTATGTCTGTTTTTTTTTTTTTTTTAC
TGGAGTGAAATGAAATGGTTGTGGCTTGCTCTTTATCATG
GGAAGGTGGAAGAGCCATGCATGGCTACATGTCTTAAGGG
TTGATCCCCTGTAGTGAGTTTCTAATGGGTATCATATGCT
CCAACATATTTCTGCTCAAATCAATTGGTGTCGTTGTGAC
TCACGGACATTTATGATGACCAAACAAGAATGAGATGATG
AGAGAATTTCCAGAGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dusp13a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000040779 (1),  Ensembl_Trans:ENSDART00000123866 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154634 (1) 1201 nt
CITATIONS (2)