ZFIN ID: ZDB-TSCRIPT-090929-20882
Transcript Name: si:ch211-223p8.8-201
Previous Name: si:ch211-223p8.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040777 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040777|OTTDARG00000029670|ZDB-GENE-090313-91 si:ch211-223p8.8|OTTDARP00000032588 CH211-223P8.8-001 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 561 bp
ATGGAGGATACTGATCAAATATTGGACAACGTTTTGCATA
AATCTCCCACTATTGAAGAGCTGGAGGGTATATTACATGG
GGGTCAGTTGTCTTGTAACCACGTCGATGAAGTGTGGCCT
AATTTGTTCCTGGGAGACATGTACATGTCTCACGACAGAT
ATGGCCTGTGGAGCCTAGGTGTCACACATGTTTTAAATGC
TGCACATGGTAAAATGTGTTGCAAAGGAAATGATGATTAT
TATGGGACAACCGTGAAGTATTATGGTGTGCCAGCCAATG
ATTTGCCAACATTTGATATTTCACCTTTCTTCTACCCGTC
TGCACAGTACATTCATGATGCGCTCAGCACAACAGGCGCT
AAAGTTTTTGTGCATTGTGCTGTGGGGATGAGCCGTTCAG
CTGCTCTGGTCCTAGCTTACCTAATGATTTATTGCAATTT
CTCTCTTGTGGATGCCATCTTGAAAGTGAAAGAAAGAAGA
TGGATTTTCCCAAACCGAGGATTTCTGAAACAGTTAATAA
CTCTTGACAATGAATTAAAACTACAAGGCACCAGTAACTA
G

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-223p8.8-201 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000040777 (1),  Ensembl_Trans:ENSDART00000147194 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)