ZFIN ID: ZDB-TSCRIPT-090929-20537
Transcript Name: lyst-003
Previous Name: si:ch211-30i2.1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040384 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040384|OTTDARG00000029434|ZDB-GENE-070702-1 lyst|OTTDARP00000032276 CH211-30I2.1-003 LG_none CU074338.9,AL928828.6 Danio rerio protein_coding NOVEL, 749 bp
GTCCAGTGCGGAGGACTGTCTGGTGCTGATCTGCTGTGGT
CTGTATGATCTGCTGAGAGGAGTTCTGCTTCTGCTGCCGG
ACCTCCTGCTGGAGGAAGTGATGGACAAACTCATCCAGCC
TGACGCTCTTCTCGTTCTGGTCAACCACCCGTCTCCCCTC
ATCCAGCAGGGCGTCATGAAGCTCCTGGACGCCTACTTCA
GCCGCGCTCAGAAAGAGCAGAAGGAGAAGTTCCTGAAGAA
CCACGGCTTCTCACTGCTGGCCAATCAGCTGTACCAGCAC
CAGGGTTCACAGGGGCTGCTGGAGTGCTTCCTGGAGATGC
TGTTCGGACGACCGGTCGGTCTCGAGGAAGATCTGGATCT
GGAGGATATGGAGAACATCTCTCCATTCAGGAAGCGCTGT
ATCATCCCAGTGCTGGGTCTGCTGGAGAACTCTCTGTATG
AGAACTCACTGGTGCACAATGGCCTGTGTCTGCTGCTGCA
GCTCCTCAACGCCTGCCCGAAGCTGGCCGACATCCTGCTG
GACCACGGCTTACTCTACGTGCTCTTCAACACACTCTCCA
CCCTCAACGGCCTGGAGAACGGGATTCCTCCGAATGACTA
CAGGCTGGTGGTGTGTGACATTCAGCAGCTGCTGGTGGCC
GTCACCATACACTCCTGCAGCTCTTCTGGATCTCAGTACT
TCCGCATCATTGAAGACTTGATCACACTGTTGGGCTACAT
GCAAACCAGCAAAGTTCGCCGCACACAGG

lyst TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA lyst-001 (1) 3815
lyst-002 (1) 1565
lyst-003 749
lyst-004 (1) 1295
lyst-202 (1) 2266
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lyst-003 Contained in:
OTHER lyst-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040384 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)