header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2030
Transcript Name: mfsd12a-201
Previous Names: mfsd12a-001, si:dkey-218h11.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011628 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011628|OTTDARG00000010127|ZDB-GENE-030131-4642 mfsd12a|OTTDARP00000010025 mfsd12a-001 LG_ BX548024.4 Danio rerio protein_coding KNOWN, 2817 bp
AGAAAATGAGGGACCCAGAGCCTTGAACTTCACACAGACT
CGTTATTGCTGTCCCTGCGGCGAGGAGGAAGCCGGAGAGG
ACACAATATGCTGAGCTGGATTAAAGGGAATATACATTTT
TAGCTGGCCGGGGGTTCAGAGTGTCGCCTTCATCATGCAG
GACTCCTCCGAAGCTTCTCTGCCCGTAATCAGGCGCTTGA
GTTACTCAGTTGGGCATTTTCTCAACGACCTGTGCGCCTC
TATGTGGTTTACATACCTGCTGGTGTTTTACCACTCAGTG
CTCGGCTTTGAGAACACATACGCGGGTGTGCTACTACTAG
TGGGGCAGATAGCAGACGGGGTTTGTACACCGCTCATCGG
CTACGAGTCTGACCGGACGCCCGGCTGCGGCTCCTACGGA
AAGAGGAAGACATGGCATCTAGTCGGGACCATCAGCGTGC
TCCTATCATTCCCCTTCATATTTAACCAGTGCCTGGGCTG
TGATCTGAACACTCCACAGTGGGTCAGTGTCACCTATTTC
GCCCCCTTCATCATCATCTTCCAGTTTGGATGGGCGGCCA
CCCAGATTTCCCATCTGTCCCTCATTCCTGAGCTGGTGTC
GTGTGAGCATGAGAAAGTGGAGCTCACTGCATACAGGTAT
GCCTTTACAGTGATAGCCAACATCACAGTGTATGCAGTGG
CATGGCTGCTGTTTCATTTCCAAGAGGGAGATGATCCTGC
TGTTATGGATAACCTCGGTCCGGTTGACATCCCTGTTTTC
AGAAATCTGAGTCTTATCGTAGTGGGAATCGGAGCTGTGT
TCACCTTCCTGTTTCACTTGGGCACGCGGGAGAAGGGTCG
TCCCTTTCAGGAGGAGGATGGGTCCAGTCCTGGGGAGAGG
CAGCCACTTATTAACAACACCACTGTGGCTCCTCCAGCCA
ATCTACTGCACTGGAATAACTGGCTCACACAGCCCTCATT
CTACCAAGTTGCACTGCTTTATATGTCCACCAGACTGATA
GTAAACCTGTCACAAACATACATCTCCATGTATCTCACCT
ACACACTACTGCTGCCAAAGAATTACATAGCCACTATTCC
TCTGGTCATGTTTCTGAGTGGCTTTGCTTCCTCTTTTATA
ATGAAGCCTGTCAGCAAGCTGATAGGCAAATGTATGACCT
ATTTTCTGGGTCTGCTGCTGATTCTGGCGTTCTCCTATTG
GGTGCTGCTGGACACACACATGGGAGATAAGGTGTATGGG
GCAGCGGTGCTGCTTGGAGTGGGCTCTGCGACCATCCTGG
TCATGTCTCTTGCCATGACGGCTGAACTCATAGGAGACCA
GACACATAGCGGGGCTTTTGTTTATGGTGCGATGAGCTTC
ACAGACAAAGTGGCCAATGGTCTGGGAGTGATGATCATTC
AGACGCTTCACCCTTGTCGCACAATGGTCTGCTGTCCAGC
CTGTGTGTGGTATTACCACTATGTCATGGTCATCGTCAGC
GGTGGAGTGGCCGTTTTAGCAGCGCTGAGCCTCTGCACGA
TCCTTATCTGGCCTATAAAGATTGTGCGCTATCTTCCAGA
AGTGGCTGGACTGATGGAAAGTGATGAGGATTCAGAGAGC
TCCGAACAGCCTTCAGTCAACTGAACACACAGCAGAAACT
CTTCAGATCCCATGCAGAGACACTTTGGTTGACATTTCCA
TCCCAGTGGTGAAGGTTAGATCAGGATAATCTTTCACACA
GGCAAATGTATGCCAGTAAAGTCATAGAGCACTTATATCT
TCACATATAAGGGAATTTCAAGGTTCATCTTGTGTTCACT
GAGAGCCAAAGATGTGCTCAGATTATCTAGTTTAAAATAG
TTTTTGTTATTGCATTTATGTGTTTTCACTAAACCCAGCA
GTCTTATAGACACGCTTCATAAAGGGACTAACATTATTAT
ATTGTTGGTATTTTTATTATTTGTCAATTGTTTTTATTTA
TGATTATATGTTGAGTTCAAATATTTAAATCATGACATTA
AGGGAATTTATTTACAGAAAGCACTTACTGTATCATAAAG
GACTGCAAAACTACAGAGGTTTTAATGGAATTGTCAATGC
AAAGTGCATGTTTTCATTTCAGGAGATGGTTGAAATAAAC
ACATCTAAGGGAATTCTTTGAAGACAAAAAGGGAAGATTA
TGTTTTAAATCAAGGACATAAGGCCATGTGTTGTCATTTC
AAGATTTATATTAAGGGAGTGAGATTTGAACACAACAGAA
AATATTTTGAAACAAATGTTGGGATCTGAACATTTATTGG
TTACCACTGACAAAACAAAATACAAAAGTCAATGGTGTTC
ATCAACTGGAAGTGGAAGTCAATGGTGACCAATCATTCTG
GAAATGAGCTACTCTTTATATTTTTCCAAAATGATGTGCA
ATTTTTTTCAGGAACCACTAGCTTTTTTTCTTCATATATA
CATAATTGTTTTCATATGAAAGACGTGTCTGACATGTTTT
CTGTTCATATCATTTTCTGAACAGAACAAATGTTCTTTAT
GAACGGATATTTCTGTATCTTGATTTGATACATTGTAACT
AGTTACTGATTAGCGTGAATGCAGTGTCAGAGTGAGCAGT
TGCATCTGGTCACCTGATCTTGCATGATGCTTAAGGCTTT
TAAAACGCACATCATAAAAGCTGTTCCGCATATAAATAAA
CTTAAATACACGCTATTTATTGTGGAATCAGTCAAATCAA
ATCAGAATGTTTGTAAAAACAAAGAATTGTATTATATAAT
ATATTTCAAGTCTTGTTCAAAGCAGCTTTTTAAATAAAAG
TGTTTTTTTTAATTGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mfsd12a-201 Contained in:

OTHER mfsd12a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000011628 (1)
  • Ensembl_Trans:ENSDART00000088867 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA787306 (1) 915 bp
    GenBank:BI889504 (1) 787 bp
    GenBank:AL723113 (1) 680 bp
    GenBank:BI891606 (1) 597 bp
    GenBank:BF717378 (1) 482 bp
    CITATIONS (2)