header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20224
Transcript Name: gnaq-201
Previous Names: gnaq-001, si:ch73-270f14.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040006 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040006|OTTDARG00000029200|ZDB-GENE-081104-25 gnaq|OTTDARP00000031977 gnaq-001 LG_ CU468920.7 Danio rerio protein_coding KNOWN, 1745 bp
GCTGAGACCATACCGAGCCATATATCAAGCTGGGATTTAA
AATAACCGGAGTACAGACCTTGGTGGAGTAATTTACACAT
TCGCTTTAGACGCGTGGACTCCGATTCGCTGTATGATACG
GTTGCAGGCTTCGCTACGTTTGTAACCGGAATTCCAAGGA
ATTGTCAGCCATATTCAGCGATACCACGCCCGGAGCGGAT
CCGTTAACACGGGAGGAACACCGTTCATGCAAATATAGGC
TACCCAGCCGCAAGTTCATGGACTGCAGAGTTTAACGCTG
TCTAAAGAAATAAAACTGTTTTAAGGGCGATTCTCAAGTA
TTTATTTTAATCAACCGGTCTGCAATGGAGCTATGAAGTC
CAAACGATCTGTTGCTTTTATGAGTGATATAAAACACATA
CCAGCCGCATAAGGATTTAAGTAACTGTTAACCGCTAACA
GTTACACCTGAATGGTGTATTATATCATTGTCGTGTTCCA
AGACTTGCAGAAACATTAACGTTAGTGTATCTCAATGAGG
CTTTATGAATTGCTTTTCAGAGCGCAGCAGATGAACTCCT
TCTCTCTCTCTGGCAATCTGGTCGATTTGGATTGAGTTGG
GACTGATGTGCTTTCAATGGCATTTCTGAAAACATCTTAA
TTGTGAAGTGACAGGGAGAATCATGACGCTGGACTCCATC
ATGGCGTGCTGTCTCAGCGAGGAGGCGAAAGAAGCGCGGC
GGATCAACGATGAGATCGACCGACAGCTCCGGAGAGACAA
GAAAGACGCCCGACGCGAGCTCAAGCTGTTGCTGCTGGGA
ACTGGGGAGAGTGGGAAAAGCACCTTTATTAAACAGATGA
GAATCATCCATGGCTCAGGCTATTCAGAAGAAGACAGAAA
AGGCTTTACCAAGCTGGTCTACCAAAACATCTTCACGTCT
TCACAGTCCATGATACGAGCAATGGACACTCTCCAGATTC
TCTATAAATATGAACACAATAAGGCCAATGCAAACATTGT
CAGAGAAGTGGATGTAGAGAAAGTCTTCTTGTTCGTCAAC
CCCTATGTAGATGCGATTAAGAGTTTATGGAATGACCCAG
GAATTCAGGAGTGCTATGACCGGAGACGAGAATACCAGCT
CTCAGATTCCACAAAATATTATCTAAATTCATTGGATCGC
ATTGCCAACCCTTCCTACATTCCCACCCAGCAAGATGTGC
TCAGGGTGAGAGTGCCCACAACAGGCATCATCGAATACCC
CTTTGACCTACAAAGCGTCATATTCAGGATGGTGGATGTT
GGGGGTCAGCGATCAGAAAGGCGAAAGTGGATCCACTGTT
TTGAAAACGTCACCTCCATCATGTTCCTGGTAGCACTCAG
TGAATATGACCAAGTTCTCGTCGAGTCTGACAATGAGAAT
CGAATGGAGGAAAGCAAAGCATTGTTTAGGACGATAATAA
CATACCCCTGGTTTCAGAATTCATCTGTTATTCTTTTTCT
GAACAAGAAAGACCTTTTGGAAGAGAAAATAATGTTTTCA
CATCTTGTAGATTACTTTCCCGAATATGATGGACCTCAGA
GAGATGCTCAAACTGCACGGGAGTTCATCCTGAAGATGTT
TGTCGACCTGAATCCAGACTCAGAGAAAATCATTTATTCT
CATTTCACATGTGCCACTGACACGGAAAACATTCGATTTG
TGTTCGCTGCTGTCAAAGACACAATCTTGCAGCTCACGCT
TAAAGAATACAATCTGGTGTGAAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gnaq-201 Contained in:

OTHER gnaq-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040006 (1)
  • Ensembl_Trans:ENSDART00000013229 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EL647434 (1) 872 bp
    GenBank:EE203790 (1) 556 bp
    GenBank:EE202878 (1) 506 bp
    CITATIONS (2)