header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20223
Transcript Name: gna14-201
Previous Names: gna14-001, si:ch73-270f14.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040005 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040005|OTTDARG00000029199|ZDB-GENE-040808-7 gna14|OTTDARP00000031976 gna14-001 LG_none CU856361.5,CU468920.7 Danio rerio protein_coding KNOWN, 2023 bp
ATCACAGCTCCTGAGGTAGGCGTGTTCCCATAGACTTTCT
TCAAGACGATTCTTTTAATACTGCCTAGTGAGCTGATGTA
TGCATTGACTGTGAAGTACTGGAGGTGGTTAAGACGGTTC
AGGATGGAGGAGTGCTGTTTATCAGGCGAAGAAAAAGAGA
AAATGAGGATTCACCAAGAAATTGAGAGGAAGCTAAAAAT
GGACAAGCGGAGTTCCAACAAAGAATTGAAGCTTTTACTT
TTAGGCACAGGAGAGAGTGGGAAGAGCACTTTCATCAAGC
AGATGAGAATTATACATGGCAAGGGCTACACAGAGGAAGA
CAAGAGGTCCTTTGCCAAACTGGTGTACCAGAATGTCTTT
ACTTCCATTCAAAGCATGCTTAAAGCCATGGAGAACCTGA
AAATCCCCTTTGCTGAAAGCAAAAATGAAACATTTGCTGC
AATGCTTAAGGAGGTGGAAGCAGAATCAGTGCAAACAATG
GAGGCTAAATATGCTGAAGCCATCAAGAGTGTGTGGAAAG
ACCAAGGCCTGCAGAAATGCTATGAACGCAGGAGAGAGTA
TCAGTTATCCGACTCTACCAAATATTACCTTGATGACATG
GACAGAATAGCTGCAGGGTTTTACATGCCGACCTTGCAGG
ATATTCTACGAGTCCGAGTTCCAACCACAGGCATCATTGA
ATACGTCTTTGACCTTCAGAGTGTTCTATTCAGAATGGTT
GATGTCGGAGGCCAAAAGTCAGAAAGACGGAAGTGGATCC
ATTGTTTTGAAAACGTCACATCTGTAATCTTCTTGGTGGC
TCTGAGCGAATATGATCAGTTCTTATTTGAGAGTGCGAAT
GAGAATCGAATGGAAGAAAGCAAGGCACTTTTTAAGACAA
TCATCTCCTATCCCTGGTTTCAGGATTCCTCTGTCATTTT
GTTCCTTAATAAGACAGATATCCTGAAGGATAAGATCTTA
AAGTCAGACCTTGCGAAGTATTATCCACAGTTCACAGGGC
CTAAAAATGATGCAGATGCTGCAATGAAGTTCATCTTGAA
AATGTATGAGGAACAGAACCCCGACAAACAGAAGCGGATC
TATGCACATTTTACCTGTGCGACTGACACTGAAAATATCC
GTTTTGTTTTTGAAGCAGTAAAGGACACCATTCTGCGCAA
CACCCTCAGCGCATTTAACTTAGGTTAGGTGACAGGAGTG
TTTTTGCATATACTGTTAGAATGGTTTTTACTCCTGATCC
AATGAAAAGCTTTATATGATCTGTGAATGAAGACTGACAT
TGCTGTATGGAAATATTGTGTGAACTTATAGCCTGCTTGT
GCTTACATAAATTATAGACATGCCCAAAAAAGAAATGTCT
AATTTTATGTTAATCAGAGGCATGCGACACAGGTTTGGAA
CAACATGAGGTAGAGTGAATGATAAGATAATTTTTATTTA
GTGTTAGCTGTCTTTTAAACTTTTTTAAAAAAGAATATTT
TTTCAGGAAATGTCAGGAACTTTTTTTTTCTCTCCACTAG
GATATTTTTCTATATGAAATGCTTTATTATGCTAAATAGA
TCTAAATTTACTGCAATACCTTAATTTGTAATATCAGGTG
AATTAGATAAATATTTTTATTGATACTTAATGTAGCATCT
GTTGTGAATATCTTCAATATTGCATTCTATTTCTAACAGA
TTTTAATAAAATATGAATTAAGCCTTATAGCATGAAAGGG
ACGCTTTGAATCCATGCAAATCCTGTGTAGCCACTGTCTT
TGCTATTCAAACAATCTGCTTAAAACTGACATGGACATAA
GAATGATGCCATTATACAGATTGTTTCATGTTTATTGTAA
CATGATTACAGATTAATTCAGTGAAAAGTGGGAAAAAAGC
TGCTGCTTATTGTAAAATGTACCGAGAAATCCAATCAAAT
ACTTTTGCATTTAGCAGCCATTGCATATTATTTAATAAAT
AAAAAATTTTATTATTTGTTTTTACATTTAAATTTCATTA
AAGGACTTTTTTTCCAGTAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gna14-201 Contained in:
[Fosmid] CH1073-420F13 (1) (order this)
OTHER gna14-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040005 (1)
  • Ensembl_Trans:ENSDART00000148436 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC077106 (1) 1955bp
    GenBank:DT064072 (1) 792bp
    GenBank:DT070578 (1) 714bp
    GenBank:BQ259507 (1) 574bp
    CITATIONS (2)