header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-20064
Transcript Name: yeats2-204
Previous Names: yeats2-001, si:ch73-60l17.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039817|OTTDARG00000029058|ZDB-GENE-081104-292 yeats2|OTTDARP00000031833 CH73-60L17.1-001 LG_ CU467875.8 Danio rerio protein_coding KNOWN, 2212 bp
TAGTTACAGTTGCCAAGAGCGTCAACATGCCCCTCATCAG
CCTGCCAAAGGGGGCGGGGCCATCTGCAGTGAGTGGGGCC
AAAAGCTCCAGTCCCTCATTAGTAACTGCAGCATCACTGA
TTGGAGGAGGAACGGTTAGCGGGAAAACTGCTGCCACCAT
CTCAGGTATGTTGAAGTTGCACCCAGCTCAGTCCAGTTCC
CAGCAGACAGTTCTCACCATTCCAGCCAATCAGCTTAAGC
AGCTTAGTGTGGGCAGTGGCTCCTCAGGCCTGCAGACCAT
CTTGATGCCTGTTGGCAAAGTTGTACAGTCTGGTTCTAAA
GCTACATCTAACAACAACTCCACCCCAAGTGGAGCTGCTT
CCTCAGCATCCACACCTATAGCTCAAGTTAAAACTGAACC
TGGTTTGGTGAGCTCCACTTGTACGACTCCTGTACCCCAA
ACATCTGCCCCGACCTCTGCAGCACCCGCCTCTGCACCAC
TGCCGACAGCCCCCACATCCACAGATGCAGCTGCTACTGT
CAAAGTAGAACAGGGCTTGGAGTCTACAACACATGAACTC
ATTAACACGGAGCATATAGAAAACATGACGCAACTTCTGA
CAGCCATAGTGAAGAAATTCCCTCTGATTGTCCCAGAGAA
AAATGAGGACTCTCATCCTTTCTGCGCCACGTCTGTGGAT
CAGTATTACTCCTGGAACATTGGCAAACGCAGAGCTGCAG
AGTTGCAGCGAGCAGTGGCTGTGCGGCGTGTGTGTGCGGA
TCTATTAGAGCGAACCCCCCGACTTCAGGCCCTCACTCCA
GCAAGAACTAAAGAGGTGCTGCGCTGGTGCCGTCTCCGAG
GATACACGCCTCCTGACCCAGAACCCCAGCGCACAGAGGA
GGACTCCATCGAGGACATACTCACACAGATTGACAGCGAA
CCAGAGTGCAGCTCGACTTTGACAGGCTGTGAAGAACTTT
CTCAACGTCTAGAGCAACTTCAGAGGATCCTGAAAGCGGA
GCCCGATGAGGAGGACGATGAACTGCTTGACATCATCAGT
GTAAAGGAATTAGATGCCGGGAAGGTCAAAATTAAACAGG
AACAGGACGAGGCTGAACAAGAGCCCAAGTTCTACATGGG
TCGCTGTCCATCGACCCAGCTCATCAGAGACACGGCGGAG
CAGATTGGTGTGACACTCCAGCAGGTGGAGGTGGAGAAGA
ACGTTTTTGCTCCTGTTGTGGAGGCCATGATTCTTAAGGC
TGTAGAACAGTTTTCCAGTGAAATCCTCAGGGAATCGTTG
GCCAATGCGCATGGGAAATCCCAACAAAACAGAACTCCGA
GAGAGATATCAGCTATGGATGTGCATCAGGCCATTTGCTC
TATTCCCACCTGTGATTTTTTGACTAATAGGTACATGGGC
ATCATGGTGAAGGATGAAGGCCATGCTGAATAATTTTACA
GCTTCTTCGCGTGATCTGACCACAGATGGACAGGTGGACC
GCTCACTCCTTCCTCTCACATTCTATAAAGGTGGAAAATG
TGACCAATCACAGGCCCATGTCCTTACAGGAGTCAGACAT
TGTCGTGACAACAGCTCAGTTTATATACTGAGTGTATTAA
AACCAAGAGTAACATCAAAAAACAATAACTTTGAAGGGTT
GACGCTCAGCCTGAACAGTATTTGTTTTATATGCCTCTAT
TTATTCCATCTTTCATTAATTAATTCTCTGGTATTTATAA
AAGATGGTCTGGTTTATTATTCCAACTAATGTACAGTGTT
ATCTTTTTAAAGAAACACAATTCAGGCCCCAGTTATGTCA
ATAATAGTGAATTTACTCTTAAATTAACTTATTCTGACTT
CACAGAGTCTTTCAATCTCTGCAAATGCAACCATCACATG
ATTTTGCCGTTGACGCAGAGCTGTTTAACTTGTCTTAGTT
TTAAAGGGGCAGTTCACCCAAAAATGGAAATTCTGTAATA
TTTGCTCACCCTCCACTTGTTCCAAGCCTATTTGCATTTC
TTTCTTCTGGTAAACGCAAAAGAAGATACTTTCTGAAGAA
TGTGGAAAAGCAGCAGTCATTGACTGTCATAGTAATTTTT
GTTCCTACTATGGATGTCAATGGCTGCTGGCTTCCAACAT
TCTTCACTGTAAAAAATTCTGGGTTCCACACAATTGTTTT
GTGTTGGAACAATATGAAGGAATTAAATTAACTTAATAGT
TTTTACAAATTT

yeats2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA yeats2-202 (1)    Ensembl 2630
yeats2-204 2212
yeats2-205 (1)    Ensembl 540
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
yeats2-204 Contained in:
[BAC] CH73-60L17 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000039817 (1),  Ensembl_Trans:ENSDART00000139137 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CA470514 (1) 884 bp
GenBank:CD599408 (1) 650 bp
GenBank:EB909455 (1) 367 bp
CITATIONS (2)