ZFIN ID: ZDB-TSCRIPT-090929-198
Transcript Name: tgfa-202
Previous Names: tgfa-001, si:ch211-10e8.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002359 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002359|OTTDARG00000002188|ZDB-GENE-040724-208 tgfa|OTTDARP00000002086 tgfa-001 LG_none CR293534.5,AL732598.10 Danio rerio protein_coding KNOWN, 3007 bp
CCCAGCAGTGCACTCCTCTTTTAACTCGCGCGCGCGCACG
CAAAGCAGAAGGATGTTCAGGGTGTGGAGAGTCCTGCGCT
CTGAGTAATCTATAAAGCAGTTCTCTACTTAACCATATTT
CACCCCTGTTTTACCATCTTTAACATCATGGTGAATTAGA
AATAAATAGTTAGCGTTTCATATGACGTCAACAGAAAGAC
GACGTTGCTCAAGTTTGACGTCAAGTTCAAAATACCTGGA
TCGACGCATGGCGTCTTGTGTCGAGTAGGCGACATGGAAC
TATGAAGAAAGACGTTCAGAGTTTTAATATGGAAATCAGA
TTTCTGACCAGTGCAACGGACGGTCAGTAATAACTACTAC
TAGCCAATCTCAGGAAAACGCGCGTGCCTTCATCTTTATT
GGCAAAGATAAATGTTTTAATATAAAAGACGACGCTGAGA
ATCTTTCATCAACAACTCACCCAAACGCCTTATAATGATG
TATCGTGCTTTTTGGGATACAATATTCCTTCTCACCGGCT
CCCTTTTTACGTATGGGCAGGTGCAAGAGAATTCTACCTC
AACGACGACTATTGCAACCACGACAACAACTACTACAACA
ACTACCACCACTACCACCACCAGCACCACGACCACCACTA
CTACCACACGAGTCAGAAAATTTATAGCAGCTGCAGTCCA
CTCTCACTTTGATGACTGTCCCGACTCCCACAGCCACTTC
TGTTTTCATGGCACATGTCGTTTTCTCATCCTGGAGGAAA
CACCTGCATGTGTATGCCATCCTGGCTTTGTGGGCATGCG
GTGTGAACATGCAGATCTCCTAGCAGTGGTGGCATCAAAC
CACCGGCAGCAGACCGTGGCCACCATGCTGGTGTTGTGTG
TGGTGGGCAGTGTCATGCTCATGCTGATCTGCACTTTACT
TAATTGTTGGTGGAGACGGGGTGGTTGTGGGCGAGGTCAC
ACCCTCTCCTGTTGGACGGAGAAGCCTAGGAGTATTTTGA
CGAGTGGGACATCCTGCTGTAACTCAGAAACAGTGGTTTG
ACGCAGGTTTTCTGGAGCTCACTCAGGTGCCCTCTTAAAA
CAAAAAAAGACAGCAACATCTTCCACCTTGCTCCTGGACT
TTACAATGACTGCGTTTCCTAAGCTACAGACTTGCAGAGC
TGGTAAGCGCAGCACATGTTCAATATGGGCAGTGGGAGAA
CTCGAGCAAACATGGGACTTTTATATTCAGAGAGACTGAG
TAGTTCCAAAAAGAAGATTGTTGGAACAGTAACTGCTAAT
GATGGAACTCAAAAGCTCGGAATGGAAAAATCTGAACAAA
ATGGAACTCGACTACAGAAGATACTCGGCCATTTTGGGGA
AAAGATATGGATCTGTGGCTTAAACGAGAGTGAAAAACTT
TGAGAGAGGTTTTAACGAAATCATTCTTACTAACAGAGCT
TATCTTAAAGCTTTATAGTGTATGTATTAGACAACATTCT
CCCAGTCTTTGTTTTTTAAATACTCAATATATCAAAACAC
ACTTATAATCTGCCGTTAATGGGATGTGAAACTCACTTTA
AAAAAATCGTTTTTATTAAGGATATATCATCACATTCTTT
TCTCTATCACGTTACGGCTAAAGAATGGGAGATTTCTTTT
CTTACCATTTAAGTCAGTTAAGCAGTTAGTAATACTACAG
AATATTTTGCCAATTTATTTTAACTTAATCTCTTTATAAT
GCTGATTTAAAGACGAAAAACAAAGTGTAACAGCTAACAT
GAGAGACCAGAGCTTTGAGGGACAAATCCTACTTCTGACA
CGTTATTCTTTAACACTTTTTATCTGAATGGAGTTTCATT
TTTTTATGTGCGTTTTAAAATCTAAATATTGGTGAACAAG
TCACAATTATGACATGTAACTTGACAAGTTATGCATAGAT
TCACGAATCCCACACAAGATTTTCTTCACCTAATGTGCTT
TCAAAGATTTCTCAACATCTCTAAATGCTTTGGAAATGGA
TCCTCTGTATGCGCACTATTTTTGAAGCGTCACATGATAT
CTGCATGTTCACACTGAATGCATGCGTGTTTGAGCACATA
ATTACACACAATGCACTTTTGCGGTGTAGATTTCCACCTC
ACTGTTAATACAAACCACCTTCAAATCTGCACTTTAGATC
CTTTTCCATTATAGGCGTCACTCACTCACAATTGTAAGCA
TACAGAGGCGCAGATCCACGATATAAGCAATCATAATGGA
TGATGTTCAGTTTGATGCACGTTGTATTATGCAAGATATA
TAGAAGCTTTTACACTGAAATGTTTTAAACCGTGTTCATT
TTGCTTTCTTTTCTAATCTTATCTGTCCCTAAGCTTTTGC
CAATGACCTCATGTTATAAAAAGATGTTCGACTGACCCCT
TTGTAAGGTATTTGCTCTTTTAGGGTCAGAGATATTTATA
TTGATATGTTAAAATGAGGTGCTGGTACATATATAAAGTA
ACCACTGTGGGTTGCATTCATACAAAACCCTTCTCAAGCT
GGTAAGTGGCTGATATAGCGCTTAAAAAAAAAGATAAATA
TTGATAAAAATACTAATAATTTGATCAGATTAATGATCTG
ACTGTTCTGGCATCAGATCATGAAGGAAATATGTGATGTT
ATTGTGTGAAGATTCATTTAAAAATGTGATCTAATGCCCT
AGTGAGTTGAAGAGGATTCATCTAGGTGGCTTTTTTGAGT
TATCAAGTCTTTAAATGATTTTGATCAGCCTGAAAAAACT
GGTTCAAATGGTTTATGATCTAGTTGGCTGACCCTGATAT
GTGACTTAAAGGAAACATTCACTCAAAAACACTCATTTGC
AGTTCATTTATTCACTTTTTGATCAATCCAAAATGTAATG
TAGGATGTAAAAAATGTTTTACAGTCTTTGGTGATTCATA
GTGAATGGCTACTAGTGCTTTGAGAGTCTAACGCATAAAG
CACAGGTCTCAAACTCAATTCCTGGAGAGCCGCAGCTCTG
CACAGTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tgfa-202 Contained in:
OTHER tgfa-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002359 (1)
  • Ensembl_Trans:ENSDART00000151419 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)